Previous Contig 010681:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046O08Sequence549008006 (4)gb:ATAC009853_15430472e-52Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc396010681 (5)gb:ATAC009853_15430473e-11Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc
JMSF019N06Sequence532010681 (5)gb:ATAC009853_15430471e-60Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc738010681 (5)gb:ATAC009853_15430476e-55Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc
JMSF040B21Sequence577008006 (4)gb:ATAC009853_15430477e-53Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc813010681 (5)gb:ATAC009853_15430471e-65Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc
JMSF050K03Sequence702008006 (4)gb:ATAC009853_15430478e-64Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc769010681 (5)gb:ATAC009853_15430471e-54Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019N06- GGTGGCTTGTGCTACACAGATTCAGCTGGGGTTAATTTGCAGAATTTGAAAATGGA
rJMSF040B21+ TAATTTGCAGAATTTGAAAATGGA
                      ____________________________________________________________
consensus GGTGGCTTGTGCTACACAGATTCAGCTGGGGTTAATTTGCAGAATTTGAAAATGGA
 
. : . : . : . : . : . :
JMSF019N06- GGCATCTCATTTCAGGGATGAACTGTGGACAGGAATTCGTGATCTTAGTAAGAAAACTGA
rJMSF040B21+ GGCATCTCATTTCAGGGATGAACTGTGGACAGGAATTCGTGATCTTAGTAAGAAAACTGA
rJMSF019N06+ AAAACTGA
rJMSF050K03+ AAAACTGA
                      ____________________________________________________________
consensus GGCATCTCATTTCAGGGATGAACTGTGGACAGGAATTCGTGATCTTAGTAAGAAAACTGA
 
. : . : . : . : . : . :
JMSF019N06- TTTGATTGTTCTTGTTCATAACTTGTCTCACCGAATACCTAGATACAGTGAATCAACTGC
rJMSF040B21+ TTTGATTGTTCTTGTTCATAACTTGTCTCACCGAATACCTAGATACAGTGAATCAACTGC
rJMSF019N06+ TTTGATTGTTCTTGTTCATAACTTGTCTCACCGAATACCTAGATACAGTGAATCAACTGC
rJMSF050K03+ TTNGATTGTTCTTGTTCATAACTTGTCTCACCGAATACCTAGATACAGTGAATCAACTGC
                      ____________________________________________________________
consensus TTTGATTGTTCTTGTTCATAACTTGTCTCACCGAATACCTAGATACAGTGAATCAACTGC
 
. : . : . : . : . : . :
JMSF019N06- AACACAGCCGAAACCAGCTCTATCGCTTCTCTTGGACGAGGCTAAATCTCTTGGAATTCC
rJMSF040B21+ AACACAGCCGAAACCAGCTCTATCGCTTCTCTTGGACGAGGCTAAATCTCTTGGAATTCC
rJMSF019N06+ AACACAGCCGAAACCAGCTCTATCGCTTCTCTTGGACGAGGCTAAATCTCTTGGAATTCC
rJMSF050K03+ AACACAGCCGAAACCAGCTCTATCGCTTCTCTTGGACGAGGCTAAATCTCTTGGAATTCC
                      ____________________________________________________________
consensus AACACAGCCGAAACCAGCTCTATCGCTTCTCTTGGACGAGGCTAAATCTCTTGGAATTCC
 
. : . : . : . : . : . :
JMSF019N06- TTGGGTGCTTGCTATTACAAACAAATTTTCTGTTAGCGCACATCAGCAAAAGGCAGCTAT
rJMSF040B21+ TTGGGTGCTTGCTATTACAAACAAATTTTCTGTTAGCGCACATCAGCAAAAGGCAGCTAT
rJMSF019N06+ TTGGGTGCTTGCTATTACAAACAAATTTTCTGTTAGCGCACATCAGCAAAAGGCAGCTAT
rJMSF050K03+ TTGGGTGCTTGCTATTACAAACAAATTTTCTGTTAGCGCACATCAGCAAAAGGCAGCTAT
                      ____________________________________________________________
consensus TTGGGTGCTTGCTATTACAAACAAATTTTCTGTTAGCGCACATCAGCAAAAGGCAGCTAT
 
. : . : . : . : . : . :
JMSF019N06- AGATTCTGTTCTTCATGCATATCAAGCGTCTCCTAGCACAACCGAGGTTATCAATTCGTG
rJMSF040B21+ AGATTCTGTTCTTCATGCATATCAAGCGTCTCCTAGCACAACCGAGGTTATCAATTCGTG
rJMSF019N06+ AGATTCTGTTCTTCATGCATATCAAGCGTCTCCTAGCACAACCGAGGTTATCAATTCGTG
rJMSF050K03+ AGATTCTGTTCTTCATGCATATCAAGCGTCTCCTAGCACAACCGAGGTTATCAATTCGTG
                      ____________________________________________________________
consensus AGATTCTGTTCTTCATGCATATCAAGCGTCTCCTAGCACAACCGAGGTTATCAATTCGTG
 
. : . : . : . : . : . :
JMSF019N06- TCCCTATGTTCTGCCCAGTGCATCAGGCGCTCCTCTATCTTGGAAAACAGAGGGGGTAGG
rJMSF040B21+ TCCCTATGTTCTGCCCAGTGCATCAGGCGCTCCTCTATCTTGGAAAACAGAGGGGGTAGG
rJMSF019N06+ TCCCTATGTTCTGCCCAGTGCATCAGGCGCTCCTCTATCTTGGAAAACAGAGGGGGTAGG
rJMSF050K03+ TCCCTATGTTCTGCCCAGTGCATCAGGCGCTCCTCTATCTTGGAAAACAGAGGGGGTAGG
                      ____________________________________________________________
consensus TCCCTATGTTCTGCCCAGTGCATCAGGCGCTCCTCTATCTTGGAAAACAGAGGGGGTAGG
 
. : . : . : . : . : . :
JMSF019N06- TCCGAAAGAAATAATAGGTGCTCATAAGCTGATCTTCGCTCCACTTGAACTCGTAACAAG
rJMSF040B21+ TCCGAAAGAAATAATAGGTGCTCATAAGCTGATCTTCGCTCCACTTGAACTCGTAACAAG
rJMSF019N06+ TCCGAAAGAAATAATAGGTGCTCATAAGCTGATCTTCGCTCCACTTGAACTCGTAACAAG
rJMSF050K03+ TCCGAAAGAAATAATAGGTGCTCATAAGCTGATCTTCGCTCCACTTGAACTCGTAACAAG
                      ____________________________________________________________
consensus TCCGAAAGAAATAATAGGTGCTCATAAGCTGATCTTCGCTCCACTTGAACTCGTAACAAG
 
. : . : . : . : . : . :
JMSF019N06- ACCTTTTCGTAAGAAAGCTTCTGTTTTCCCAGTAGAGGGTGTATCTACTCTTCGTG
rJMSF040B21+ ACCTTTTCGTAAGAAAGCTTCTGTTTTCCCAGTAGAGGGTGTATCTACTCTTCGTGAAGT
rJMSF019N06+ ACCTTTTCGTAAGAAAGCTTCTGTTTTCCCAGTAGAGGGTGTATCTACTCTTCGTGAAGT
rJMSF050K03+ ACCTTTTCGTAAGAAAGCTTCTGTTTTCCCAGTAGAGGGTGTATCTACTCTTCGTGAAGT
                      ____________________________________________________________
consensus ACCTTTTCGTAAGAAAGCTTCTGTTTTCCCAGTAGAGGGTGTATCTACTCTTCGTGAAGT
 
. : . : . : . : . : . :
rJMSF040B21+ TATACACCGTGTGCTCCGTAGCTATGAGGAAGCCGCCTTGCAGGAGTTTGCGAAAGACAG
rJMSF019N06+ TATACACCGTGTGCTCCGTAGCTATGAGGAAGCCGCCTTGCAGGAGTTTGCGAAAGACAG
rJMSF050K03+ TATACACCGTGTGCTCCGTAGCTATGAGGAAGCCGCCTTGCAGGAGTTTGCGAAAGACAG
rJMFF046O08+ ATGAGGAAGCCGCCTTGCAGGAGTTTGCGAAAGACAG
                      ____________________________________________________________
consensus TATACACCGTGTGCTCCGTAGCTATGAGGAAGCCGCCTTGCAGGAGTTTGCGAAAGACAG
 
. : . : . : . : . : . :
rJMSF040B21+ ACTATTCTTAGAACTGGTAAAGGAGCATGCAGTCGCTGCAAATGCAAGTAGAGAGGCAAA
rJMSF019N06+ ACTATTCTTAGAACTGGTAAAGGAGCATGCAGTCGCTGCAAATGCAAGTAGAGAGGCAAA
rJMSF050K03+ ACTATTCTTAGAACTGGTAAAGGAGCATGCAGTCGCTGCAAATGCAAGTAGAGAGGCAAA
rJMFF046O08+ ACTATTTTTAGAACTGGTAAAGGAGCATGCAGTCGCTGCAAATGCAAGTAGAGAGGCAAA
                      ____________________________________________________________
consensus ACTATTCTTAGAACTGGTAAAGGAGCATGCAGTCGCTGCAAATGCAAGTAGAGAGGCAAA
 
. : . : . : . : . : . :
rJMSF040B21+ GGCCAAGGAAAACGCTCTTTCTTCCGCCACTGTTGGAGCATCCCTTGGCGCCGGTCTTGG
rJMSF019N06+ GGCCAAGGAAAACGCTCTTTCTTCCGCCACTGTTGGAGCATCCCTTGGCGCCGGTCTTGG
rJMSF050K03+ GGCCAAGGAAAACGCTCTTTCTTCCGCCACTGTTGGAGCATCCCTTGGCGCCGGTCTTGG
rJMFF046O08+ GGCCAAGGAAAACGCTTTTTTTTCCGCCACTGTTGGAGCATCCCTTGGCGCCGGTTTTGG
                      ____________________________________________________________
consensus GGCCAAGGAAAACGCTCTTTCTTCCGCCACTGTTGGAGCATCCCTTGGCGCCGGTCTTGG
 
. : . : . : . : . : . :
rJMSF040B21+ CCTTGTGTTGGCAGTAGTAATGGGTGCAGGATCTGCTTGGAGAAAGCCTTGAAAATTTTG
rJMSF019N06+ CCTTGTGTTGGCAGTAGTAATGGGTGCAGGATCTGCTTGGAGAAAGCCTTGAAAATTTTG
rJMSF050K03+ CCTTGTGTTGGCAGTAGTAATGGGTGCAGGATCTGCTTGGAGAAAGCCTTGAAAATTTTG
rJMFF046O08+ CCTTGTGTTGGCAGTAGTAATGGGTGCAGGATTTGCTTGGAGAAAGCCTTGAAAATTTTG
                      ____________________________________________________________
consensus CCTTGTGTTGGCAGTAGTAATGGGTGCAGGATCTGCTTGGAGAAAGCCTTGAAAATTTTG
 
. : . : . : . : . : . :
rJMSF040B21+ ACATGTTTTTAGGCCCGCATTGAAATGGTTAGGTTTTGCATTCAAATGTGAATACA-CAT
rJMSF019N06+ ACATGTTTTTAGGCCCGCATTGAAATGGTTAGGTTTTGCATTCAAATGTGAATACACCAT
rJMSF050K03+ ACATGTTTTTAGGCCCGCATTGAAATGGTTAGGTTTTGCATTCAAATGTGAATACA-CAT
rJMFF046O08+ ACATGTTTTTAGGCCCGCATTGAAATGGTTAGGTTTTGCATTCAAATGTGAATACA-CAT
                      ____________________________________________________________
consensus ACATGTTTTTAGGCCCGCATTGAAATGGTTAGGTTTTGCATTCAAATGTGAATACA-CAT
 
. : . : . : . : . : . :
rJMSF040B21+ GTACAATAGT
rJMSF019N06+ GTACAATAGT
rJMSF050K03+ GTACAATAGTGTTCTGATTAGGCGAGAAAAATGG
rJMFF046O08+ GTACAATAGTGTTTTGATTAGGCGAGAAAAATGGTATAAACTATTTATTTTTTTACCCAG
                      ____________________________________________________________
consensus GTACAATAGTGTTTTGATTAGGCGAGAAAAATGGTATAAACTATTTATTTTTTTACCCAG
 
. : . : . : . : . : . :
rJMFF046O08+ TAATTGTTTTGACTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTAAAAAAAAAAAAAAAA
                      ____________________________________________________________
consensus TAATTGTTTTGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAAAAAAAAAAA