Previous Contig 010670:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025D05Sequence608010670 (11)gb:AB085684_15244172e-38Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.777010670 (11)gb:AB085684_15244172e-44Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.
JMFF032C05Sequence764010670 (11)gb:AB085684_15244174e-45Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.
JMFF035I10Sequence421010670 (11)gb:AB085684_15244176e-14Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.751010670 (11)gb:AB085684_15244172e-43Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.
JMFF038K17Sequence420010670 (11)gb:AB085684_15244171e-16Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.295010670 (11)
JMFF046L22Sequence419010670 (11)gb:AB085684_15244176e-14Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.402010670 (11)gb:GMU64915_16807281e-10Glycine max farnesylated protein GMFP4 mRNA, partial cds.
JMSF003A12Sequence787010670 (11)gb:AB085684_15244178e-50Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.
JMSF013M06Sequence786010670 (11)gb:AB085684_15244171e-45Arabidopsis thaliana TOM2A mRNA for tobamovirus multiplication 2A, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035I10- GCAATCTGTCAACCCCGTGATCTCTCCTACTCCCTGTTCACAAACATGA
JMFF038K17- GCAATCTGTCAACCCCGTGATCTCTCCTACTCCCTGTTCACAAACATGA
JMFF046L22- GCAATCTGTC-ACCCCGTGATCTCTCCTACTCCCTGTTCAC-AACATGA
JMFF025D05- CCTTTGCAATCTGTCAACCCCGTGATCTCTCCTACTCCCTGTTCACAAACATGA
                      ____________________________________________________________
consensus CCTTTGCAATCTGTCAACCCCGTGATCTCTCCTACTCCCTGTTCACAAACATGA
 
. : . : . : . : . : . :
JMFF035I10- GGATTTTGTGATTTAGCTGAGAGTTGTGCAAGGAGCTTTGAGTTGTGGGGGTTTGCTAGA
JMFF038K17- GGATTTTGTGATTTAGCTGAGAGTTGTGCAAGGAGCTTTGAGTTGTGGGGGTTTGCTAGA
JMFF046L22- GGATTTTGTGATTTAGCTGAGAGTTGTGCAAGGAGCTTTGAGTTGTGGGGGTTTGCTAGA
JMFF025D05- GGATTTTGTGATTTAGCTGAGAGTTGTGCAAGGAGCTTTGAGTTGTGGGGGTTTGCTAGA
                      ____________________________________________________________
consensus GGATTTTGTGATTTAGCTGAGAGTTGTGCAAGGAGCTTTGAGTTGTGGGGGTTTGCTAGA
 
. : . : . : . : . : . :
JMFF035I10- ATTTTCTAGAGAATGGCGTGTAAAGGGTGTTTGGAGTGCTTGCTGAAGCTCTTTAACTTC
JMFF038K17- ATTTTCTAGAGAATGGCGTGTAAAGGGTGTTTGGAGTGCTTGCTGAAGCTCTTTAACTTC
JMFF046L22- ATTTTCTAGAGAATGGCGTGTAAAGGGTGTTTGGAGTGCTTGCTGAAGCTCTTTAACTTC
JMFF025D05- ATTTTCTAGAGAATGGCGTGTAAAGGGTGTTTGGAGTGCTTGCTGAAGCTCTTTAACTTC
                      ____________________________________________________________
consensus ATTTTCTAGAGAATGGCGTGTAAAGGGTGTTTGGAGTGCTTGCTGAAGCTCTTTAACTTC
 
. : . : . : . : . : . :
JMFF035I10- TTATTGACCCTTGTTGGACTGGGAATGATTGGATATGGTGTATATCTCTTTGTGGAATAC
JMFF038K17- TTATTGACCCTTGTTGGACTGGGAATGATTGGATATGGTGTATATCTCTTTGTGGAATAC
JMFF046L22- TTATTGACCCTTGTTGGACTGGGAATGATTGGATATGGTGTATATCTCTTTGTGGAATAC
JMFF025D05- TTATTGACCCTTGTTGGACTGGGAATGATTGGATATGGTGTATATCTCTTTGTGGAATAC
                      ____________________________________________________________
consensus TTATTGACCCTTGTTGGACTGGGAATGATTGGATATGGTGTATATCTCTTTGTGGAATAC
 
. : . : . : . : . : . :
JMFF035I10- AAAAACCACTCTTCATCTGGTGATATTGAGCCTCCGTCGAGTTTTGAAGTGATGCAGCTA
JMFF038K17- AAAAACCACTCTTCATCTGGTGATATTGAGCCTCCGTCGAGTTTTGAAGTGATGCAGCTA
JMFF046L22- AAAAACCACTCTTCATCTGGTGATATTGAGCCTCCGTCGAGTTTTGAAGTGATGCAGCTA
JMFF025D05- AAAAACCACTCTTCATCTGGTGATATTGAGCCTCCGTCGAGTTTTGAAGTGATGCAGCTA
                      ____________________________________________________________
consensus AAAAACCACTCTTCATCTGGTGATATTGAGCCTCCGTCGAGTTTTGAAGTGATGCAGCTA
 
. : . : . : . : . : . :
JMFF035I10- GGTCGCCCTATGCTTATGGCTGTATCTTTCGCAAACAACATATTCGATAACCTCCCAAAT
JMFF038K17- GGTCGCCCTATGCTTATGGCTGTATCTTTCGCAAACAACATATTCGATAACCTCCCAAAT
JMFF046L22- GGTCGCCCTATGCTTATGGCTGTATCTTTCGCAAACAACATATTCGATAACCTCCCAAAT
JMFF025D05- GGTCGCCCTATGCTTATGGCTGTATCTTTCGCAAACAACATATTCGATAACCTCCCAAAT
                      ____________________________________________________________
consensus GGTCGCCCTATGCTTATGGCTGTATCTTTCGCAAACAACATATTCGATAACCTCCCAAAT
 
. : . : . : . : . : . :
JMFF035I10- GCTTGGTTCATATATTTGTTTATTGGTATCGGCGTAGTTATTTGTGTAATATCTTGCTTT
JMFF038K17- GCTTGGTTCATATATTTGTTTATTGGTATCGGCGTAGTTATTTGNGTAATATCTTGCTTT
JMFF046L22- GCTTGGTTCATATATTTGTTTATTGGTATCGGCGTAGTTATTTGTGTAATATCTTGCTTT
JMFF025D05- GCTTGGTTCATATATTTGTTTATTGGTATCGGCGTAGTTATTTGTGTAATATCTTGCTTT
                      ____________________________________________________________
consensus GCTTGGTTCATATATTTGTTTATTGGTATCGGCGTAGTTATTTGTGTAATATCTTGCTTT
 
. : . : . : . : . : . :
JMFF035I10- GGCTGC
JMFF038K17- GGCTGC
JMFF046L22- GGCTGC
JMFF025D05- GGCTGCATTGGAGGTGCGACGAGGAATGGGTGCTGCCTGTCTTGTTATTCTGTGTTAGTA
rJMSF003A12+ GACGAGGAATGGGTGCCGCCNGTCTTGTTATTCTGTGTTAGTA
rJMFF032C05+ GTTAGTA
rJMFF035I10+ GTTAGTA
rJMFF025D05+ GTTAGTA
                      ____________________________________________________________
consensus GGCTGCATTGGAGGTGCGACGAGGAATGGGTGCTGCCTGTCTTGTTATTCTGTGTTAGTA
 
. : . : . : . : . : . :
JMFF025D05- ATGTTGTTGATCTT-GGTAGAACTTGGAGCTGCTGCATTTATATTCTTTGACAAAAGTTG
rJMSF003A12+ ATGTTGTTGATCTT-GGTAGAACTNGGAGCTGCTGCATTTATATTCTTTGACAAAAGTTG
rJMFF032C05+ ATGTTGTTGATCTT-GGTAGAACTTGGAGCTGCTGCATTTATATTCTTTGACAAAAGTTG
rJMFF035I10+ ATGTNGTTGATCTTGGGTAGAACTTGGAGCTGCTGCATTTATATTCTTTGACAAAAGTTG
rJMSF013M06+ TGATCNT-GGTAGAACTTGGAGCTGCTGCATTTATATTCTTTGACAAAAGTTG
rJMFF025D05+ ATGTTGTTGATCTT-GGTAGAACTNGGAGCTGCTGCATTTATATTCTTTGACAAAAGTNG
                      ____________________________________________________________
consensus ATGTTGTTGATCTT-GGTAGAACTTGGAGCTGCTGCATTTATATTCTTTGACAAAAGTTG
 
. : . : . : . : . : . :
JMFF025D05- GAAGAAGGAAATTCCAACAGACAAAACGGGTAACTTTGATACGATATATGAATTTTTGGA
rJMSF003A12+ GAAGAAGGAAATTCCAACAGACAAAACGGGTAACTTTGATACGATATATGAATTTTTGGA
rJMFF032C05+ GAAGAAGGAAATTCCAACAGACAAAACGGGTAACTTTGATACGATATATGAATTTTTGGA
rJMFF035I10+ GAAGAAGGAAATTCCAACAGACAAAACGGGTAACTTTGATACGATATATGAATTTTTGGA
rJMSF013M06+ GAAGAAGGAAATTCCAACAGACAAAACGGGTAACTTTGATACGATATATGAATTTTTGGA
rJMFF025D05+ GAAGAAGGAAATTCCAACAGACAAAACGGGTAACTTTGATACGATATATGAATTTTTGGA
                      ____________________________________________________________
consensus GAAGAAGGAAATTCCAACAGACAAAACGGGTAACTTTGATACGATATATGAATTTTTGGA
 
. : . : . : . : . : . :
JMFF025D05- AGACCACTGGGACAT
rJMSF003A12+ AGACCACTGGGACATTGCTAGATGGGTGGCCCTTGGGGCAGTAGTGTTGGAGGCCCTTGT
rJMFF032C05+ AGACCACTGGGACATTGCTAGATGGGTGGCCCTTGGGGCAGTAGTGTTGGAGGCCCTTGT
rJMFF035I10+ AGACCACTGGGACATTGCTAGATGGGTGGCCCTTGGGGCAGTAGTGTTGGAGGCCCTTGT
rJMSF013M06+ AGACCACTGGGACATTGCTAGATGGGTGGCCCTTGGGGCAGTAGTGTTGGAGGCCCTTGT
rJMFF025D05+ AGACCACTGGGACATTGCTAGATGGGTGGCCCTTGGGGCAGTAGTGTTGGAGGCCCTTGT
                      ____________________________________________________________
consensus AGACCACTGGGACATTGCTAGATGGGTGGCCCTTGGGGCAGTAGTGTTGGAGGCCCTTGT
 
. : . : . : . : . : . :
rJMSF003A12+ ATTCTTGTTGGCACTTGTGGTAAGGGCAGCGAACAGACCGGCCGACTATGATAGCGATGA
rJMFF032C05+ ATTCTTGTTGGCACTTGTGGTAAGGGCAGCGAACAGACCGGCCGACTATGATAGCGATGA
rJMFF035I10+ ATTCTTGTTGGCACTTGTGGTAAGGGCAGCGAACAGACCGGCCGACTATGATAGCGATGA
rJMSF013M06+ ATTCTTGTTGGCACTTGTGGTAAGGGCAGCGAACAGACCGGCCGACTATGATAGCGATGA
rJMFF025D05+ ATTCTTGTTGGCACTTGTGGTAAGGGCAGCGAACAGACCGGCCGACTATGATAGCGATGA
                      ____________________________________________________________
consensus ATTCTTGTTGGCACTTGTGGTAAGGGCAGCGAACAGACCGGCCGACTATGATAGCGATGA
 
. : . : . : . : . : . :
rJMSF003A12+ TGAGTATATAGGCGGCGGTCCTAGACAACAGATCCGCCAGCCACTGGTTAACAACAACTG
rJMFF032C05+ TGAGTATATAGGCGGCGGTCCTAGGCAACAGATCCGCCAGCCACTGGTTAACAACAACTG
rJMFF035I10+ TGAGTATATAGGCGGCGGTCCTAGACAACAGATCCGCCAGCCACTGGTTAACAACAACTG
rJMSF013M06+ TGAGTATATAGGCGGCGGTCCTAGACAACAGATCCGCCAGCCACTGGTTAACAACAACTG
rJMFF025D05+ TGAGTATATAGGCGGCGGTCCTAGACAACAGATCCGCCAGCCACTGGTTAACAACAACTG
                      ____________________________________________________________
consensus TGAGTATATAGGCGGCGGTCCTAGACAACAGATCCGCCAGCCACTGGTTAACAACAACTG
 
. : . : . : . : . : . :
rJMSF003A12+ GCAATCCTCTAGCCCTCAAAGCGCACCTGTTGCTGCTGACTCTCGGGCGCCTAGTCGGAC
rJMFF032C05+ GCAATCCTCTAGCCCTCAAAGCGCACCTGTTGCTGCTGACTCTCGGGCGCCTAGTCGGAC
rJMFF035I10+ GCAATCCTCTAGCCCTCAAAGCGCACCTGTTGCTGCTGACTCTCGGGCGCCTAGTCGGAC
rJMSF013M06+ GCAATCCTCTAGCCCTCAAAGCGCACCTGTTGCTGCTGACTCTCGGGCGCCTAGTCGGAC
rJMFF025D05+ GCAATCCTCTAGCCCTCAAAGCGCACCTGTTGCTGCTGACTCTCGGGCGCCTAGTCGGAC
                      ____________________________________________________________
consensus GCAATCCTCTAGCCCTCAAAGCGCACCTGTTGCTGCTGACTCTCGGGCGCCTAGTCGGAC
 
. : . : . : . : . : . :
rJMSF003A12+ TGATGCATGGAGTGCTCGTATGAGGGAAAAGTACGGGCTTGACACTTCGGAGTTTACATA
rJMFF032C05+ TGATGCATGGAGTGCTCGTATGAGGGAAAAGTACGGGCTTGACACTTCGGGGTTTACATA
rJMFF035I10+ TGATGCATGGAGTGCTCGTATGAGGGAAAAGTACGGGCTTGACACTTCGGAGTTTACATA
rJMSF013M06+ TGATGCATGGAGTGCTCGTATGAGGGAAAAGTACGGGCTTGACACTTCGGAGTTTACATA
rJMFF025D05+ TGATGCATGGAGTGCTCGTATGAGGGAAAAGTACGGGCTTGACACTTCGGAGTTTACATA
rJMFF046L22+ TATGAGGGAAAAGTACGGGCTTGACACTTCGGAGTTTACATA
                      ____________________________________________________________
consensus TGATGCATGGAGTGCTCGTATGAGGGAAAAGTACGGGCTTGACACTTCGGAGTTTACATA
 
. : . : . : . : . : . :
rJMSF003A12+ CAATCCATCGGAGCCAAACCGGCACCAACAAACAGCTGCACAACCTCCAGAGGAGAGTAG
rJMFF032C05+ CAATCCATCGGAGCCAAACCGGCACCAACAAACAGCTGCACAACCTCCAGAGGAGAGTAG
rJMFF035I10+ CAATCCATCGGAGCCAAACCGGCACCAACAAACAGCTGCACAACCTCCAGAGGAGAGTAG
rJMSF013M06+ CAATCCATCGGAGCCAAACCGGCACCAACAAACAGCTGCACAACCTCCAGAGGAGAGTAG
rJMFF038K17+ AAACAGCTGCACAACCTCCAGAGGAGAGTAG
rJMFF025D05+ CAATCCATCGGAGCCAAACCGGCACCAACAAACAGCTGCACAACCTCCAGAGGAGAGTAG
rJMFF046L22+ CAATCCATCGGAGCCAAACCGGCACCAACAAACAGCTGCACAACCTCCAGAGGAGAGTAG
                      ____________________________________________________________
consensus CAATCCATCGGAGCCAAACCGGCACCAACAAACAGCTGCACAACCTCCAGAGGAGAGTAG
 
. : . : . : . : . : . :
rJMSF003A12+ TCGATGTACTATAATGTGACGATATAATATGGTTTGCGTCGTGGAGCAACCGTGTTGTTA
rJMFF032C05+ TCGATGTACTATAATGTGACGATATAATATGGTTTGCGTCGTGGAGCAACCGTGTTGTTA
rJMFF035I10+ TCGATGTACTATAATGTGACGATATAATATGGTTTGCGTCGTGGAGCAACCGTGTTGTTA
rJMSF013M06+ TCGATGTACTATAATGTGACGATATAATATGGTTTGCGTCGTGGAGCAACCGTGTTGTTA
rJMFF038K17+ TNGATGTACTATAATGTGACGATATAATATGGTTTGCGTCGTGGAGCAACCGTGTTGTTA
rJMFF025D05+ TCGATGTACTATAATGTGACGATATAATATGGTTTGCGTCGTGGAGCAACCGTGTTGTTA
rJMFF046L22+ TCGATGTACTATAATGTGACGATATAATATGGTTTGCGTCGTGGAGCAACCGTGTTGTTA
                      ____________________________________________________________
consensus TCGATGTACTATAATGTGACGATATAATATGGTTTGCGTCGTGGAGCAACCGTGTTGTTA
 
. : . : . : . : . : . :
rJMSF003A12+ TTCATGTTCGCTTTTGAGTTGATTTCTTTTAGTTGATCGTATGGTTGTTTGTATCTATCC
rJMFF032C05+ TTCATGTTCGCTTTTGAGTTGATTTCTTTTAGTTGATCGTATGGTTGTTTGTATCTATCC
rJMFF035I10+ TTCATGTTCGCTTTTGAGTTGATTTCTTTTAGTTGATCGTATGGTTGTTTGTATCTATCC
rJMSF013M06+ TTCATGTTCGCTTTTGAGTTGATTTCTTTTAGTTGATCGTAAGGTTGTTTGTATCTATCC
rJMFF038K17+ TTCATGTTCGCTTTTGAGTTGATTTCTTTTAGTTGATCGTATGGTTGTTTGTATCTATCC
rJMFF025D05+ TTCATGTTCGCTTTTGAGTTGATTTCTTTTAGTTGATCGTATGGTTGTTTGTATCTATCC
rJMFF046L22+ TTCATGTTCGCTTTTGAGTTGATTTCTTTTAGTTGATCGTATGGTTGTTTGTATCTATCC
                      ____________________________________________________________
consensus TTCATGTTCGCTTTTGAGTTGATTTCTTTTAGTTGATCGTATGGTTGTTTGTATCTATCC
 
. : . : . : . : . : . :
rJMSF003A12+ CTCTGTTATGGAGTTAGTGTAAAAATCGAGTCTTTT-CCGGTTTATTATTTGGTATCTTT
rJMFF032C05+ CTCTGTTATGGAGTTAGTGTAAAAATCGAGTCTTTTGCGGGTTTATTATTTGGTATCTTT
rJMFF035I10+ CTCTGTTATGGAGTTAGTGTAAAAATCGAGTCTTTTGCGGGTTTATTATTTGGTATCTTT
rJMSF013M06+ CTCTGTTATGGAGTTAGTGTAAAAATCGAGTCTTTTGCGGGTTTATTATTTGGTATCTTT
rJMFF038K17+ CTCTGTTATGGAGTTAGTGTAAAAATCGAGTCTTTTGCGGGTTTATTATTTGGTATCTTT
rJMFF025D05+ CTCTGTTATGGAGTTAGTGTAAAAATCGAGTCTTTTGCGGGTTTATTATTTGGTATCTTT
rJMFF046L22+ CTCTGTTATGGAGTTAGTGTAAAAATCGAGTCTTTTGCGGGTTTATTATTTGGTATCTTT
                      ____________________________________________________________
consensus CTCTGTTATGGAGTTAGTGTAAAAATCGAGTCTTTTGCGGGTTTATTATTTGGTATCTTT
 
. : . : . : . : . : . :
rJMSF003A12+ TGTTTGGTCGTTGTGTACGATGTACAAATTGAATGTTTTGTGAATTTATGTTGTCTTGTG
rJMFF032C05+ TGTTTGGTCGTTGTGTACGATGTACAAATTGAATGTTTTGTGAATTTATGTTGTCTTGTG
rJMFF035I10+ TGTTTGGTCGTTGTGTACGATGTACAAATTGAATGTTTTGTGAATTTATGTTGTCTTGTG
rJMSF013M06+ TGTTTGGTCGTTGTGTACGATGTACAAATTGAATGTTTTGTGAATTTATGTTGTCTTGTG
rJMFF038K17+ TGTTTGGTCGTTGTGTACGATGTACAAATTGAATGTTTTGTGAATTTATGTTGTCTTGTG
rJMFF025D05+ TGTTTGGTCGTTGTGTACGATGTACAAATTGAATGTTTTGTGAATTTATGTTGTCTTGTG
rJMFF046L22+ TGTTTGGTCGTTGTGTACGATGTACAAATTGAATGTTTTGTGAATTTATGTTGTCTTGTG
                      ____________________________________________________________
consensus TGTTTGGTCGTTGTGTACGATGTACAAATTGAATGTTTTGTGAATTTATGTTGTCTTGTG
 
. : . : . : . : . : . :
rJMSF003A12+ TTCTCTCTAAA-TTCGAGAGACGT
rJMFF032C05+ TTCTCTCTAAATTTCGAGAGACGTTTCTTTTTATTAAA
rJMFF035I10+ TTCTCTCTAAATTTCGAGAGACGT
rJMSF013M06+ TTCTCTCTAAATTTCGAGAGACGTT
rJMFF038K17+ TTCTCTCTAAATTTCGAGAGACGT
rJMFF025D05+ TTCTCTCTAAATTTCGAGAGACGTTTCTTTTTATTAAATGGTT
rJMFF046L22+ TTCTCTCTAAATTTCGAGAGACGTTTCTTTTTATTAAATGGTTTGAGAGTTTATTTTGCC
                      ____________________________________________________________
consensus TTCTCTCTAAATTTCGAGAGACGTTTCTTTTTATTAAATGGTTTGAGAGTTTATTTTGCC