Previous Contig 010668:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019O20Sequence476010668 (39)gb:AB049723_15209123e-51Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd522010668 (39)gb:AB049723_15209124e-51Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFF046L08Sequence530003481 (46)gb:AP005527_18535271e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060499010668 (39)gb:AB049723_15209122e-32Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFF048F17Sequence398003481 (46)gb:AP005527_18535277e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060294010668 (39)
JMFF051J20Sequence576003481 (46)gb:AP005527_18535271e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060494010668 (39)gb:AB049723_15209129e-42Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN005J07Sequence624010668 (39)gb:AB049723_15209125e-78Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN005L09Sequence615010668 (39)pir|T02995|T029952e-62unspecific monooxygenase (EC 1.14.14.1) - common tobacco>gb:D64052_1674735 Nicot
JMFN007D24Sequence595010668 (39)gb:AB049723_15209123e-74Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN010G21Sequence142010668 (39)
JMFN015I22Sequence469010668 (39)pir|T02995|T029952e-41unspecific monooxygenase (EC 1.14.14.1) - common tobacco>gb:D64052_1674735 Nicot
JMFN018K11Sequence589010668 (39)gb:AB049723_15209122e-34Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN031N09Sequence516010668 (39)gb:AB049723_15209121e-66Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN032H17Sequence628010668 (39)gb:AB049723_15209124e-76Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN032N23Sequence624010668 (39)gb:AB049723_15209121e-68Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN043D15Sequence608010668 (39)gb:AB049723_15209121e-76Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN046E17Sequence538010668 (39)gb:AB049723_15209124e-67Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN046H08Sequence505010668 (39)gb:AB049723_15209127e-50Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN046I20Sequence568010668 (39)pir|T02995|T029953e-70unspecific monooxygenase (EC 1.14.14.1) - common tobacco>gb:D64052_1674735 Nicot
JMFS005D02Sequence556010668 (39)pir|T02955|T029553e-36probable cytochrome P450 monooxygenase - maize (fragment)
JMFS015D04Sequence629010668 (39)gb:AB049723_15209122e-80Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS019G08Sequence537010668 (39)gb:AB049723_15209124e-67Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS025B12Sequence625010668 (39)gb:AB049723_15209124e-87Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS032E08Sequence548010668 (39)gb:AB049723_15209125e-67Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS033E11Sequence630010668 (39)gb:AB049723_15209126e-84Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS056H11Sequence627010668 (39)gb:AB049723_15209121e-48Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS060C11Sequence622010668 (39)gb:AB049723_15209122e-67Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS062B12Sequence616010668 (39)gb:AB049723_15209123e-78Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS068F10Sequence625010668 (39)gb:AB049723_15209123e-81Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS070A11Sequence627010668 (39)gb:AB049723_15209124e-69Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS084G05Sequence627010668 (39)gb:AB049723_15209129e-50Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS085B09Sequence588010668 (39)gb:AB049723_15209123e-54Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS089D04Sequence627010668 (39)gb:AB049723_15209123e-80Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS101H12Sequence610010668 (39)gb:AB049723_15209122e-78Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS103B02Sequence418010668 (39)gb:AB049723_15209122e-25Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS104B02Sequence558010668 (39)gb:AB049723_15209121e-67Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS116H05Sequence566010668 (39)gb:AB049723_15209129e-71Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS117C10Sequence607010668 (39)gb:AB049723_15209123e-81Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFS140E04Sequence196010668 (39)pir|T02995|T029956e-22unspecific monooxygenase (EC 1.14.14.1) - common tobacco>gb:D64052_1674735 Nicot
JMFS161E11Sequence644010668 (39)gb:AB049723_15209125e-67Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS005D02- CGTGGCGGTT
                      ____________________________________________________________
consensus CGTGGCGGTT
 
. : . : . : . : . : . :
JMFS005D02- GACGGCAACGTTAGGGATTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTC
                      ____________________________________________________________
consensus GACGGCAACGTTAGGGATTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTC
 
. : . : . : . : . : . :
JMFS005D02- TGTTTAACAGCCTGCCCACCCTGGAAACGGCTCAGCCGGAGGTAGGGTCCAGCGGCTGGA
                      ____________________________________________________________
consensus TGTTTAACAGCCTGCCCACCCTGGAAACGGCTCAGCCGGAGGTAGGGTCCAGCGGCTGGA
 
. : . : . : . : . : . :
JMFS005D02- AGAGCACCACACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGG
                      ____________________________________________________________
consensus AGAGCACCACACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGG
 
. : . : . : . : . : . :
JMFS005D02- ACCGAGTGCCGTCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAG
                      ____________________________________________________________
consensus ACCGAGTGCCGTCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAG
 
. : . : . : . : . : . :
JMFS005D02- CCTCTGGCCAATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACTTCGG
                      ____________________________________________________________
consensus CCTCTGGCCAATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACTTCGG
 
. : . : . : . : . : . :
JMFS005D02- GAAAAGGATTGGCTCTGAGGGCTGGGCACGGGGGTCCCAGTCCCGAACCCGTCGGCTGTT
JMFN005L09- AAAGGATTGGCTCTGAGGGCTGGGCACGGGGGTCCCAGTCCCGAACCCGTCGGCTGTT
                      ____________________________________________________________
consensus GAAAAGGATTGGCTCTGAGGGCTGGGCACGGGGGTCCCAGTCCCGAACCCGTCGGCTGTT
 
. : . : . : . : . : . :
JMFS005D02- CGGCGGACTGCTCGAGCTGCTACCGCGGCGAGAGCGGGTCGCCGCGTGCCGGCCGGGGGA
JMFS140E04+ CTGCTACCGCGGCGAGAGCGGGTCGCCGCGTGCCGGCCGGGGGA
JMFN005L09- CGGCGGACTGCTCGAGCTGCTACCGCGGCGAGAGCGGGTCGCCGCGTGCCGGCCGGGGGA
                      ____________________________________________________________
consensus CGGCGGACTGCTCGAGCTGCTACCGCGGCGAGAGCGGGTCGCCGCGTGCCGGCCGGGGGA
 
. : . : . : . : . : . :
JMFS005D02- CGGACTGGGAACGGCTCTTTCGGGGGCCTTCCCCGGGCGTCGAACAGCCAACTCAGAACT
JMFS140E04+ CGGACTGGGAACGGCTCTTTCGGGGGCCTTCCCCGGGCGTCGAACAGCCAACTCAGAACT
JMFN005L09- CGGACTGGGAACGGCTCTTTCGGGGGCCTTCCCCGGGCGTCGAACAGCCAACTCAGAACT
JMFN046I20- CTCTTTCGGGGGCCTTCCCCGGGCGTCGAACAGCCAACTCAGAACT
                      ____________________________________________________________
consensus CGGACTGGGAACGGCTCTTTCGGGGGCCTTCCCCGGGCGTCGAACAGCCAACTCAGAACT
 
. : . : . : . : . : . :
JMFS005D02- GGTACGGACAAGGGGAATCCGACTGTTT-ATTAAAAC-AAGCATTGCGATGGTCCCTGCG
JMFS140E04+ GGTACGGACAAGGGGAATCCGACTGTTTAATTAAAACAAAGCATTGCGATGGTCCCTGCG
JMFN005L09- GGTACGGACAAGGGGAATCCGACTGTTTAATTAAAACAAAGCATTGCGATGGTCCCTGCG
JMFN046I20- GGTACGGACAAGGGGAATCCGACTGTTTAATTAAAACAAAGCATTGCGATGGTCCATGCG
                      ____________________________________________________________
consensus GGTACGGACAAGGGGAATCCGACTGTTTAATTAAAACAAAGCATTGCGATGGTCCCTGCG
 
. : . : . : . : . : . :
JMFS005D02- GATGCTAA
JMFS140E04+ GATGCTAACGCAATGTGATTTCT
JMFN005L09- GATGCTAACGCAATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAAC
JMFN046I20- GATGCTAACGCAATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAAC
                      ____________________________________________________________
consensus GATGCTAACGCAATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAAC
 
. : . : . : . : . : . :
JMFN005L09- CAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTC
JMFN046I20- CAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTC
JMFS056H11- GCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTC
JMFS084G05- GCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTC
                      ____________________________________________________________
consensus CAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTC
 
. : . : . : . : . : . :
JMFN005L09- ATCTAATTAGTGACGCGCATGAATGGATTAACGAGATTCCCACTGTCCCTGTCTACTATC
JMFN015I22- ATGGATTAACGAGATTCCCACTGTCCCTGTCTACTATC
JMFN046I20- ATCTAATTAGTGACGCGCATGAATGGATTAACGAGATTCCCACTGTCCCTGTCTACTATC
JMFS056H11- ATCTAATTAGTGACGCGCATGAATGGATTAACGAGATTCCCACTGTCCCTGTCTACTATC
JMFS084G05- ATCTAATTAGTGACGCGCATGAATGGATTAACGAGATTCCCACTGTCCCTGTCTACTATC
                      ____________________________________________________________
consensus ATCTAATTAGTGACGCGCATGAATGGATTAACGAGATTCCCACTGTCCCTGTCTACTATC
 
. : . : . : . : . : . :
JMFN005L09- CAGCGAAACCACAGCCAAGGGAACGGGCTTGGCAGAATCAGCGGGGAAAGAAGACCCTGT
JMFN015I22- CAGCGAAACCACAGCCAAGGGAACGGGCTTGGCAGAATCAGCGGGGAAAGAAGACCCTGT
JMFN046I20- CAGCGAAACCACAGCCAAGGGAACGGGCTTGGCAGAATCAGCGGGGAAAGAAGACCCTGT
JMFS056H11- CAGCGAAACCACAGCCAAGGGAACGGGCTTGGCAGAATCAGCGGGGAAAGAAGACCCTGT
JMFS084G05- CAGCGAAACCACAGCCAAGGGAACGGGCTTGGCAGAATCAGCGGGGAAAGAAGACCCTGT
JMFN032H17- GGGAACGGGCTTGGCAGAATCAGCGGGGAAAGAAGACCCTGT
                      ____________________________________________________________
consensus CAGCGAAACCACAGCCAAGGGAACGGGCTTGGCAGAATCAGCGGGGAAAGAAGACCCTGT
 
. : . : . : . : . : . :
JMFN005L09- TGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGC
JMFN015I22- TGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGC
JMFN046I20- TGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGC
JMFS056H11- TGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGC
JMFS084G05- TGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGC
JMFN032H17- TGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGC
                      ____________________________________________________________
consensus TGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGC
 
. : . : . : . : . : . :
JMFN005L09- CGAAAGGCGAAAGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGG
JMFN015I22- CGAAAGGCGAAAGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGG
JMFN046I20- CGAAAGGCGAAAGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGG
JMFS056H11- CGAAAGGCGAAAGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGG
JMFS084G05- CGAAAGGCGAAAGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGG
JMFN032H17- CGAAAGGCGAAAGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGG
JMFS033E11- AAGGCGAAAGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGG
JMFS025B12- TTATTCCGTGAATCGG
                      ____________________________________________________________
consensus CGAAAGGCGAAAGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGG
 
. : . : . : . : . : . :
JMFN005L09- AGGCGGGGCATTGCCCC
JMFN015I22- AGGCGGGGCATTGCCCCTCTTTTTGGACCCAAGGCTCGCTTGCGGGCCGATCCGGGCGGA
JMFN046I20- AGGCGGGGCATTGCCCCTCTTTTTGGACCCAAGGCTCGCTTGCGGGCCGATCCGGGCGGA
JMFS056H11- AGGCGGGGCATTGCCCCTCTTTTTGGACCCAAGGCTCGCTTGCGGGCCGATCCGGGCGGA
JMFS084G05- AGGCGGGGCATTGCCCCTCTTTTTGGACCCAAGGCTCGCTTGCGGGCCGATCCGGGCGGA
JMFN032H17- AGGCGGGGCATTGCCCCTCTTTTTGGACCCAAGGCTCGCTTGCGGGCCGATCCGGGCGGA
JMFS033E11- AGGCGGGGCATTGCCCCTCTTTTTGGACCCAAGGCTCGCTTGCGGGCCGATCCGGGCGGA
JMFS025B12- AGGCGGGGCATTGCCCCTCTTTTTGGACCCAAGGCTCGCTTGCGGGCCGATCCGGGCGGA
                      ____________________________________________________________
consensus AGGCGGGGCATTGCCCCTCTTTTTGGACCCAAGGCTCGCTTGCGGGCCGATCCGGGCGGA
 
. : . : . : . : . : . :
JMFN015I22- AGACATTGTCAGGTGGGGAG
JMFN046I20- AGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTG
JMFS056H11- AGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGT
JMFS084G05- AGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGT
JMFN032H17- AGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGT
JMFS033E11- AGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGT
JMFS025B12- AGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGT
JMFN043D15- TCAGGTGGGGAGTTTGGCTGGGGCGGCACATCCGTTAAAAGATAACGCAGGT
JMFN005J07- CATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGT
JMFS070A11+ TTAAAAGATAACGCAGGT
JMFN032N23+ AAAGATAACGCAGGT
JMFS060C11+ GATAACGCAGGT
JMFS161E11- ACGCAGGT
                      ____________________________________________________________
consensus AGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGT
 
. : . : . : . : . : . :
JMFS056H11- GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS084G05- GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFN032H17- GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS033E11- GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS025B12- GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFN043D15- GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFN005J07- GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS070A11+ GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFN032N23+ GTCCTAAGACGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS060C11+ GTCNTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS161E11- GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS117C10+ TGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS068F10+ TGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFS015D04+ ATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAANAGCTCG
JMFS101H12+ TCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFN018K11- CAGAAGGGT-AAAGCTCG
JMFS089D04+ CTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
JMFN007D24+ AAGGGTAAAAGCTCG
JMFS062B12+ AGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
                      ____________________________________________________________
consensus GTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCG
 
. : . : . : . : . : . :
JMFS056H11- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS084G05- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFN032H17- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS033E11- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS025B12- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFN043D15- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFN005J07- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS070A11+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFN032N23+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS060C11+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS161E11- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS117C10+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS068F10+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS015D04+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS116H05+ TGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS101H12+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFN018K11- TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS032E08+ CGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS089D04+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS104B02+ AATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFS019G08+ GCCTAACGATCCTTTAG
JMFN007D24+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
JMFN046E17+ GGCCTAACGATCCTTTAG
JMFN046H08+ GCCTAACGATCCTTTAG
JMFS062B12+ TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
                      ____________________________________________________________
consensus TTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTAACGATCCTTTAG
 
. : . : . : . : . : . :
JMFS056H11- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS084G05- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN032H17- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS033E11- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS025B12- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN043D15- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN005J07- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS070A11+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN032N23+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS060C11+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS161E11- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS117C10+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS068F10+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS015D04+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS116H05+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS101H12+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN018K11- ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS032E08+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS089D04+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS104B02+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS019G08+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN031N09+ TCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN007D24+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN046E17+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFN046H08+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
JMFS062B12+ ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
                      ____________________________________________________________
consensus ACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG
 
. : . : . : . : . : . :
JMFS056H11- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCT
JMFS084G05- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGAT
JMFN032H17- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS033E11- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS025B12- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFN043D15- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFN005J07- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS070A11+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFN032N23+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS060C11+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS161E11- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS117C10+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS068F10+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS015D04+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS116H05+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS101H12+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFN018K11- GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS032E08+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS089D04+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS104B02+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS019G08+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFN031N09+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFN007D24+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFN046E17+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFN046H08+ GCAGCCAAGCGTTCATAGCGACGTTGCTTT-TGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS062B12+ GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
rJMFF019O20+ CGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFF019O20- CGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
JMFS085B09+ CAGCCAAGCGTTCATAGCGACGTTGCTTTGTGATCCTTCGATGTCGGCTCTTCCTATCA
                      ____________________________________________________________
consensus GCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCA
 
. : . : . : . : . : . :
JMFN032H17- TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS033E11- TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS025B12- TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFN043D15- TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFN005J07- TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS070A11+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFN032N23+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS060C11+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS161E11- TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS117C10+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS068F10+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS015D04+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS116H05+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS101H12+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFN018K11- TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS032E08+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS089D04+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS104B02+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS019G08+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFN031N09+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFN007D24+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFN046E17+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFN046H08+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS062B12+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
rJMFF019O20+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
rJMFF051J20+ AAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFF019O20- TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
JMFS085B09+ TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
rJMFF046L08+ CAATAGGGAACGTGAGCTG
                      ____________________________________________________________
consensus TTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTG
 
. : . : . : . : . : . :
JMFN032H17- GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACA
JMFS033E11- GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS025B12- GGATTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFN043D15- GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFN005J07- GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS070A11+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFN032N23+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS060C11+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS161E11- GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS117C10+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS068F10+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS015D04+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS116H05+ GGATTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS101H12+ GGATTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFN018K11- GG-TTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS032E08+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS089D04+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS104B02+ GGGTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS019G08+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFN031N09+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFN007D24+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFN046E17+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFN046H08+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS062B12+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
rJMFF019O20+ GGGTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
rJMFF051J20+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFF019O20- GGGTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS085B09+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
JMFS103B02- CAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
rJMFF046L08+ GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
                      ____________________________________________________________
consensus GGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTA
 
. : . : . : . : . : . :
JMFS033E11- ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS025B12- ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFN043D15- ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFN005J07- ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS070A11+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFN032N23+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS060C11+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS161E11- ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS117C10+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS068F10+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS015D04+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS116H05+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS101H12+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFN018K11- ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS032E08+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS089D04+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS104B02+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS019G08+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFN031N09+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFN007D24+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFN046E17+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFN046H08+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS062B12+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
rJMFF019O20+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
rJMFF051J20+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFF019O20- ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS085B09+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
JMFS103B02- ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
rJMFF046L08+ ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
                      ____________________________________________________________
consensus ATTCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAA
 
. : . : . : . : . : . :
JMFS033E11- AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGAT
JMFS025B12- AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN043D15- AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN005J07- AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS070A11+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN032N23+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS060C11+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS161E11- AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGATTGAACGCCTCTAAGTCAGAAT
JMFS117C10+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS068F10+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS015D04+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS116H05+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS101H12+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN018K11- AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS032E08+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS089D04+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS104B02+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS019G08+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN031N09+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN007D24+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN046E17+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN046H08+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS062B12+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
rJMFF019O20+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
rJMFF051J20+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFN010G21+ TAAGTCAGAAT
JMFF019O20- AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS085B09+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
JMFS103B02- AAGCCAGTGGTGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
rJMFF048F17+ GCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
rJMFF046L08+ AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
                      ____________________________________________________________
consensus AAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAAT
 
. : . : . : . : . : . :
JMFS025B12- CCGGGCT
JMFN043D15- CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFN005J07- CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS070A11+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFN032N23+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS060C11+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS161E11- CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS117C10+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS068F10+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS015D04+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS116H05+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS101H12+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFN018K11- CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS032E08+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS089D04+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS104B02+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS019G08+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFN031N09+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFN007D24+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFN046E17+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFN046H08+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS062B12+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
rJMFF019O20+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
rJMFF051J20+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFN010G21+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFF019O20- CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS085B09+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
JMFS103B02- CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
rJMFF048F17+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
rJMFF046L08+ CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
                      ____________________________________________________________
consensus CCGGGCTAGACCGACGCATGCGCTCGTCGCCCGTTTGCCGACCCGCAGTAGGGGCCATTT
 
. : . : . : . : . : . :
JMFN043D15- GGCCCCCAAGGGCACG
JMFN005J07- GGCCCCCAAGGGCACGTGTCGTTGGCT
JMFS070A11+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFN032N23+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS060C11+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS161E11- GGCCCCC-AGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS117C10+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS068F10+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS015D04+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS116H05+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS101H12+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFN018K11- GGCCCCC-AGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS032E08+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS089D04+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS104B02+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS019G08+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFN031N09+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFN007D24+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFN046E17+ GGTCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFN046H08+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS062B12+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTTGCGGAAGGGTCACGGTGGCCGC
rJMFF019O20+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
rJMFF051J20+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFN010G21+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFF019O20- GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS085B09+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
JMFS103B02- GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
rJMFF048F17+ GG-CCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
rJMFF046L08+ GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
                      ____________________________________________________________
consensus GGCCCCCAAGGGCACGTGTCGTTGGCTAAGCCGTCGTGGCGGAAGGGTCACGGTGGCCGC
 
. : . : . : . : . : . :
JMFS070A11+ CTTGAATTA
JMFN032N23+ CTTGAATTA
JMFS060C11+ CTTGAATTAC
JMFS161E11- CTTGAA-TACAATTCCGATCGAG
JMFS117C10+ CTTGAATTACAATTCC
JMFS068F10+ CTTGAATTACAATTCCGATCGAGCGGCGAGTTGA
JMFS015D04+ CTTGAATTACAATTCCGATCGAGCGGCGAGTTGAATC
JMFS116H05+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGA
JMFS101H12+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTT
JMFN018K11- CTTGAATTACAATTCCGATCGAGCGGCGAGCT
JMFS032E08+ CTTGAATTACAATTCCGATCGAGCGGCGAGTTGAATCCT
JMFS089D04+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTT
JMFS104B02+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTT
JMFS019G08+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTT
JMFN031N09+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTT
JMFN007D24+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTT
JMFN046E17+ CTTGAATTACAATTCCGATCGAGCGGCGAGTTGAATCCTT
JMFN046H08+ CTTGAATTA
JMFS062B12+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTTT
rJMFF019O20+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTTTGCAGACGACTTAAATACGC
rJMFF051J20+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTTTGCAGACGACTTAAATACGC
JMFN010G21+ CTTGAATTACA
JMFF019O20- CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTTTGCAGACGACTTAAATACGC
JMFS085B09+ CTTGAATTACAAATCCGATCGAGCGGCGAGCTGAATCCTTTGCAGACGACTTAAATACGC
JMFS103B02- CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTTTGCAGACGACTTAAATACGC
rJMFF048F17+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTTTGCAGACGACTTAAATACGC
rJMFF046L08+ CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTTTGCAGACGACTTAAATACGC
                      ____________________________________________________________
consensus CTTGAATTACAATTCCGATCGAGCGGCGAGCTGAATCCTTTGCAGACGACTTAAATACGC
 
. : . : . : . : . : . :
rJMFF019O20+ GACGGGGTATTGTAAGGGGTAGAGTGGCCTTGCTGCCACGATCCTCTGAGATTCAGCCCT
rJMFF051J20+ GACGGGGTATTGTAAGGGGTAGAGTGGCCTTGCTGCCACGATCCTCTGAGATTCAGCCCT
JMFF019O20- GACGGGGTATTGTA
JMFS085B09+ GACGGGGTATTGTAAGGGGTAGAGTGGCCTTGCTGCCACGATCCTCTGAGATTCAGCCCT
JMFS103B02- GACGGGGTATTGTAAGGGGTAGAGTGGCCTTGCTGCCACGATCCTCTGAGATTCAGCCCT
rJMFF048F17+ GACGGGGTATTGTAAGGGGTAGAGTGGCCTTGCTGCCACGATCCTCTGAGATTCAGCCCT
rJMFF046L08+ GACGGGGTATTGTAAGGGGTAGAGTGGCCTTGCTGCCACGATCCTCTGAGATTCAGCCCT
                      ____________________________________________________________
consensus GACGGGGTATTGTAAGGGGTAGAGTGGCCTTGCTGCCACGATCCTCTGAGATTCAGCCCT
 
. : . : . : . : . : . :
rJMFF051J20+ TTGTCGCTCCGATTCGTCC
JMFS085B09+ TTGTCGCTCCGATTCGTCCCTTAAAAAAAAAAAA
JMFS103B02- TTGTCGCTCCGATTCGT
rJMFF048F17+ TTGTCGCTCCGATTCGTCC
rJMFF046L08+ TTGTCGCTCCGATTCGTCCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTGTCGCTCCGATTCGTCCCTTAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG