Previous Contig 010667:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001M12Sequence550010667 (6)gb:AY679615_16220442e-21Fragaria x ananassa basic helix-loop-helix protein mRNA, partial cds.792010667 (6)gb:AF319540_17857761e-10Arabidopsis thaliana SPATULA (SPT) mRNA, complete cds.
JMFF042A04Sequence646010667 (6)gb:AY679615_16220442e-32Fragaria x ananassa basic helix-loop-helix protein mRNA, partial cds.592010667 (6)
JMFF046L02Sequence518010667 (6)423010667 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF046L02- ACGAAGCAAAAGAACAATTAAAATTTGAGTATTTT
                      ____________________________________________________________
consensus ACGAAGCAAAAGAACAATTAAAATTTGAGTATTTT
 
. : . : . : . : . : . :
JMFF046L02- CCTTTGTAATATAAATATATAATTTCCTTTTCCGATGATTATCATCAATGGCGGATCCAT
JMFF001M12- ATCATCAATGGCGGATCCAT
JMFF042A04- CGGATCCAT
                      ____________________________________________________________
consensus CCTTTGTAATATAAATATATAATTTCCTTTTCCGATGATTATCATCAATGGCGGATCCAT
 
. : . : . : . : . : . :
JMFF046L02- ACGGAACAGGCCATCACTCTCTCGAACCGGAGGATATGTCTTCGTTTCTCCAAAATCTTC
JMFF001M12- ACGGAACAGGCCATCACTCTCTCGAACCGGAGGATATGTCTTCGTTTCTCCAAAATCTTC
JMFF042A04- ACGGAACAGGCCATCACTCTCTCGAACCGGAGGATATGTCTTCGTTTCTCCAAAATCTTC
                      ____________________________________________________________
consensus ACGGAACAGGCCATCACTCTCTCGAACCGGAGGATATGTCTTCGTTTCTCCAAAATCTTC
 
. : . : . : . : . : . :
JMFF046L02- TCCACGGCGCATCCACTTCAGCTGATGGAGACGACGGCGGGGTGCTGTTCCCTCGCCCGG
JMFF001M12- TCCACGGCGCATCCACTTCAGCTGATGGAGACGACGGCGGGGTGCTGTTCCCTCGCCCGG
JMFF042A04- TCCACGGCGCATCCACTTCAGCTGATGGAGACGACGGCGGGGTGCTGTTCCCTCGCCCGG
                      ____________________________________________________________
consensus TCCACGGCGCATCCACTTCAGCTGATGGAGACGACGGCGGGGTGCTGTTCCCTCGCCCGG
 
. : . : . : . : . : . :
JMFF046L02- CGATGGAGGCTATGGATTTCATGGGTCGGATGAGAGACGGAGCTTCTGCTCCTGCGATCG
JMFF001M12- CGATGGAGGCTACGGATTTCATGGGTCGGATGAGAGACGGAGCTTCTGCTCCTGCGATCG
JMFF042A04- CGATGGAGGCTACGGATTTCATGGGTCGGATGAGAGACGGAGCTTCTGCTCCTGCGATCG
                      ____________________________________________________________
consensus CGATGGAGGCTACGGATTTCATGGGTCGGATGAGAGACGGAGCTTCTGCTCCTGCGATCG
 
. : . : . : . : . : . :
JMFF046L02- AGCCATCTCCGAGCCTGAATTTCTCCGATCCTTCTTTATTTTACGGAGCGCAAGTGAAAG
JMFF001M12- AGCCATCTCCGAGCCTGAATTTCTCCGATCCTTCTTTATTTTACGGAGCGCAAGTGAAAG
JMFF042A04- AGCCATCTCCGAGCCTGAATTTCTCCGATCCTTCTTTATTTTACGGAGCGCAAGTGAAAG
                      ____________________________________________________________
consensus AGCCATCTCCGAGCCTGAATTTCTCCGATCCTTCTTTATTTTACGGAGCGCAAGTGAAAG
 
. : . : . : . : . : . :
JMFF046L02- AAAGTGCAGTCAATGCGTTCTCCTCGGCCGCAATTGGGGATTTTGATGCAACTGGCTCTT
JMFF001M12- AAAGTGCAGTCAATGCGTTCTCCTCGGCCGCAATTGGGGATTTTGATGCAACTGGCTCTT
JMFF042A04- AAAGTGCAGTCAATGCGTTCTCCTCGGCCGCAATTGGGGATTTTGATGCAACTGGCTCTT
                      ____________________________________________________________
consensus AAAGTGCAGTCAATGCGTTCTCCTCGGCCGCAATTGGGGATTTTGATGCAACTGGCTCTT
 
. : . : . : . : . : . :
JMFF046L02- CCAAGCGGATTGAGTTCGAAAATGATAACAAGGGTTGTGAAACTTCAGATGCACTGAGTA
JMFF001M12- CCAAGCGGATTGAGTTCGAAAATGATAACAAGGGTTGTGAAACTTCAGATGCACTGAGTA
JMFF042A04- CCAAGCGGATTGAGTTCGAAAATGATAACAAGGGTTGTGAAACTTCAGATGCACTGAGTA
                      ____________________________________________________________
consensus CCAAGCGGATTGAGTTCGAAAATGATAACAAGGGTTGTGAAACTTCAGATGCACTGAGTA
 
. : . : . : . : . : . :
JMFF046L02- ATCTGGCTCAGCCGCGGCCCTCGAAGAGGAGCAGATCAGCAGAGGTTCATAATTTGTCTG
JMFF001M12- ATCTGGCTCAGCCGCGGCCCTCGAAGAGGAGCAGATCAGCAGAGGTTCATAATTTGTCTG
JMFF042A04- ATCTGGCTCAGCCGCGGCCCTCGAAGAGGAGCAGATCAGCAGAGGTTCATAATTTGTCTG
                      ____________________________________________________________
consensus ATCTGGCTCAGCCGCGGCCCTCGAAGAGGAGCAGATCAGCAGAGGTTCATAATTTGTCTG
 
. : . : . : . : . : . :
JMFF046L02- AAA
JMFF001M12- AAAAGAGGAGAAGGAGCCGGATCAATGAGAAACTTAAAGCGTTACAGACCTTGATTCCAA
JMFF042A04- AAAAGAGGAGAAGGAGCCGGATCAATGAGAAACTTAAAGCGTTACAGACCTTGATTCCAA
                      ____________________________________________________________
consensus AAAAGAGGAGAAGGAGCCGGATCAATGAGAAACTTAAAGCGTTACAGACCTTGATTCCAA
 
. : . : . : . : . : . :
JMFF001M12- ATTCTAACAAAACAGACAAGGCATCAATGCTGGATGAAGCCATTGAATAT
JMFF042A04- ATTCTAACAAAACAGACAAGGCATCAATGCTGGATGAAGCCATTGAATATTTGAAACAGC
rJMFF001M12+ ACAAGGCATCAATGCTGGATGAAGCCATTGAATATTTGAAACAGC
                      ____________________________________________________________
consensus ATTCTAACAAAACAGACAAGGCATCAATGCTGGATGAAGCCATTGAATATTTGAAACAGC
 
. : . : . : . : . : . :
JMFF042A04- TTCAACTGCAAGTGCAGATGCTGACCATGCGGAATGGATTGAACTTGTACCCGGGTTATT
rJMFF001M12+ TTCAACTGCAAGTGCAGATGCTGACCATGCGGAATGGATTGAACTNGTACCCGGGTTATT
                      ____________________________________________________________
consensus TTCAACTGCAAGTGCAGATGCTGACCATGCGGAATGGATTGAACTTGTACCCGGGTTATT
 
. : . : . : . : . : . :
JMFF042A04- TCCAGGGATCCTTACAATCAGTCCAACTGCCTTCAT
rJMFF001M12+ TCCAGGGATCCTTACAATCAGTCCAACTGCCTTCATNTGGGGGTGAATTTGACAAAGGAA
                      ____________________________________________________________
consensus TCCAGGGATCCTTACAATCAGTCCAACTGCCTTCATNTGGGGGTGAATTTGACAAAGGAA
 
. : . : . : . : . : . :
rJMFF001M12+ ATGCAATGCTGAACACAAGAGGATCAGCAGCTACTTTTTCTGGAAACCAAGAAATCTTAG
                      ____________________________________________________________
consensus ATGCAATGCTGAACACAAGAGGATCAGCAGCTACTTTTTCTGGAAACCAAGAAATCTTAG
 
. : . : . : . : . : . :
rJMFF001M12+ CTCAGACCAGCAGCTTTCAGATTTCTAATCAAAATTCCACAGCCCATCAAACTATGGAAA
rJMFF042A04+ AGACCAGCAGCTTTCAGATTTCTAATCAAAATTCCACAGCCCATCAAACTATGGAAA
                      ____________________________________________________________
consensus CTCAGACCAGCAGCTTTCAGATTTCTAATCAAAATTCCACAGCCCATCAAACTATGGAAA
 
. : . : . : . : . : . :
rJMFF001M12+ ATAACACTGCTAATTCAGAGAACCCAATAGCTCTGGGAACATCAATTCAAAACCATTATG
rJMFF042A04+ ATAACACTGCTAATTCAGAGAACCCAATAGCTCTGGGAACATCAATTCAAAACCATTATG
                      ____________________________________________________________
consensus ATAACACTGCTAATTCAGAGAACCCAATAGCTCTGGGAACATCAATTCAAAACCATTATG
 
. : . : . : . : . : . :
rJMFF001M12+ GACTTCTTAACCAGTTGGCATCTACTAAGGATCTGTGCAGGGACGATGCACTATCAAGAT
rJMFF042A04+ GACTTCTTAACCAGTTGGCATCTACTAAGGATCTGTGCAGGGACGATGCACTATCAAGAT
                      ____________________________________________________________
consensus GACTTCTTAACCAGTTGGCATCTACTAAGGATCTGTGCAGGGACGATGCACTATCAAGAT
 
. : . : . : . : . : . :
rJMFF001M12+ TGCATTTAGAGACGAGTTGCTCTGGGAACAATTCATCACCGGGCATCTCTTCTTAGTCAG
rJMFF042A04+ TGCATTTAGAGACGAGTTGCTCTGGGAACAATTCATCACCGGGCATCTCTTCTTAGTCAG
                      ____________________________________________________________
consensus TGCATTTAGAGACGAGTTGCTCTGGGAACAATTCATCACCGGGCATCTCTTCTTAGTCAG
 
. : . : . : . : . : . :
rJMFF001M12+ CAAAGAAATACAGTGTCGGCAGTGTCCTTTTGGTCCATCTTCCATCCCCATACGGCCTCC
rJMFF042A04+ CAAAGAAATACAGTGTCGGCAGTGTCCTTTTGGTCCATCTTCCATCCCCATACGGCCTCC
rJMFF046L02+ CAGTGTCGGCAGTGTCCTTTTGGTCCATCTTCCATCCCCATACGGCCTCC
                      ____________________________________________________________
consensus CAAAGAAATACAGTGTCGGCAGTGTCCTTTTGGTCCATCTTCCATCCCCATACGGCCTCC
 
. : . : . : . : . : . :
rJMFF001M12+ CAACTCCTCGACAGGGATCCAGGAAATGCCAATCCGGGGTACAAAAAAACTTCTCATAAT
rJMFF042A04+ CAACTCCTCGACAGGGATCCAGGAAATGCCAATCCGGGGTACAAAAAAACTTCTCATAAT
rJMFF046L02+ CAACTCCTCGACAGGGATCCAGGAAATGCCAATCCGGGGTAC-AAAAAACTTCTCATAAT
                      ____________________________________________________________
consensus CAACTCCTCGACAGGGATCCAGGAAATGCCAATCCGGGGTACAAAAAAACTTCTCATAAT
 
. : . : . : . : . : . :
rJMFF001M12+ CCCATCACCGTCAAAATGGTTAACACAATAAGTTATCTTATGACATAATTTGCTATTAAT
rJMFF042A04+ CCCATCACCGTCAAAATGGTTAACACAATAAGTTATCTTATGACATAATTTGCTATTAAT
rJMFF046L02+ CCCATCACCGTCAAAATGGTTAACACAATAAGTTATCTTATGACATAATTTGCTATTAAT
                      ____________________________________________________________
consensus CCCATCACCGTCAAAATGGTTAACACAATAAGTTATCTTATGACATAATTTGCTATTAAT
 
. : . : . : . : . : . :
rJMFF001M12+ TATTTACTAATTGTCAAATACTCTTTCCGATGTTAACCATTCTTGCATTCCTACAAGGGT
rJMFF042A04+ TATTTACTAATTGTCAAATACTCTTTCCGATGTTAACCATTCTTGCATTCCTACAAGGGT
rJMFF046L02+ TATTTACTAATTGTCAAATACTCTTTCCGATGTTAACCATTCTTGCATTCCTACAAGGGT
                      ____________________________________________________________
consensus TATTTACTAATTGTCAAATACTCTTTCCGATGTTAACCATTCTTGCATTCCTACAAGGGT
 
. : . : . : . : . : . :
rJMFF001M12+ TGGTTTTCTGATTTTATAATTGTATTAGCAGTTTGTTTATTATTTATCTTAAGTTGTTGG
rJMFF042A04+ TGGTTTTCTGATTTTATAATTGTATTAGCAGTTTGTTTATTATTTATCTTAAGTTGTTGG
rJMFF046L02+ TGGTTTTCTGATTTTATAATTGTATTAGCAGTTTGTTTATTATTTATCTTAAGTTGTTGG
                      ____________________________________________________________
consensus TGGTTTTCTGATTTTATAATTGTATTAGCAGTTTGTTTATTATTTATCTTAAGTTGTTGG
 
. : . : . : . : . : . :
rJMFF001M12+ GTG-TTTGAAATTAGAGTGCGGGACATG
rJMFF042A04+ GTGTTTTGAAATTAGAGTGCGGGACATGTTACCTTAATTAGAAATGTTGTCTCC
rJMFF046L02+ GTGTTTTGAAATTAGAGTGCGGGACATGTTACCTTAATTAGAAATGTTGTCTCCATACAA
                      ____________________________________________________________
consensus GTGTTTTGAAATTAGAGTGCGGGACATGTTACCTTAATTAGAAATGTTGTCTCCATACAA
 
. : . : . : . : . : . :
rJMFF046L02+ TTCTTCTTCXXXXXXXXXXXXXXXXXXXXXXXXXXCTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTCTTCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCCAGGGTGATCCGCCATAAGG