Previous Contig 010655:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015C24Sequence580004896 (8)pir|C86228|C862286e-63hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid764010655 (10)pir|E86228|E862282e-43hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889956 Arabid
JMFF016A07Sequence565004896 (8)pir|C86228|C862286e-62hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid712010655 (10)pir|T16995|T169956e-49probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_
JMFF046J11Sequence556004896 (8)pir|T16995|T169952e-61probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_446010655 (10)gb:AX002650_14558474e-14Sequence 1 from Patent EP0856584.>gb:AX002652_1455848 Sequence 3 from Patent EP0
JMFF049A17Sequence457004896 (8)pir|C86228|C862281e-48hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid451010655 (10)pir|T16995|T169957e-15probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_
JMSF006A18Sequence251010655 (10)gb:AY088448_15734677e-21Arabidopsis thaliana clone 6748 mRNA, complete sequence.457012464 (4)gb:AF268257_17820360.002Arabidopsis thaliana PTEN-like protein mRNA, complete cds.
JMSF016D11Sequence495004896 (8)pir|C86228|C862285e-48hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid771010655 (10)pir|T16995|T169951e-62probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_
JMSF029E08Sequence672010655 (10)pir|C86228|C862287e-73hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid788010655 (10)pir|T16995|T169959e-68probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_
JMSF038M03Sequence635007240 (2)gb:AY088448_15734673e-14Arabidopsis thaliana clone 6748 mRNA, complete sequence.758010655 (10)pir|T16995|T169951e-47probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_
JMSF044N02Sequence721004896 (8)pir|C86228|C862281e-75hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid702010655 (10)pir|T16995|T169952e-55probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006A18- GAGGCATGCAGGCTATTGAATTTAA
                      ____________________________________________________________
consensus GAGGCATGCAGGCTATTGAATTTAA
 
. : . : . : . : . : . :
JMSF006A18- TTTGGAAATCTGAAGAAGAAGAAAAATATGAGCGGAGAGGAGAAGACAGTATGTGTGACT
JMSF029E08- GTATGCGTGACC
                      ____________________________________________________________
consensus TTTGGAAATCTGAAGAAGAAGAAAAATATGAGCGGAGAGGAGAAGACAGTATGTGTGACT
 
. : . : . : . : . : . :
JMSF006A18- GGTGCCTCCGGCTTCATAGCTTCTTGGCTCGTCAAGCTTCTGCTCCACCGCGGTTACACC
JMSF029E08- GGTGCTTCCGGCTTCATAGCTTCTTGGCTCGTCAAGCTTTTGCTCCACCGTGGTTACACC
                      ____________________________________________________________
consensus GGTGCTTCCGGCTTCATAGCTTCTTGGCTCGTCAAGCTTTTGCTCCACCGTGGTTACACC
 
. : . : . : . : . : . :
JMSF006A18- GTCCACGCCACCGTTCGCAACCTCAAGGATCCAAATAAGGTGGCACATCTTCTTGCGTTG
JMSF029E08- GTCCACGCCACCGTTCGCAGCCTCAAGGATCCAAATAAGGTGTCACATCTTCTTGCATTA
                      ____________________________________________________________
consensus GTCCACGCCACCGTTCGCAGCCTCAAGGATCCAAATAAGGTGTCACATCTTCTTGCGTTG
 
. : . : . : . : . : . :
JMSF006A18- GAAGGTGCCAAGGAAAGGTTGCATTTGTTTGAAGCCGACTT
JMSF029E08- GATGGTGCCAAGGAAAGACTGCATTTGTTTGAAGCCGATTTACTTGATGAAAACTCATTT
                      ____________________________________________________________
consensus GATGGTGCCAAGGAAAGGTTGCATTTGTTTGAAGCCGATTTACTTGATGAAAACTCATTT
 
. : . : . : . : . : . :
JMSF029E08- GATGATGCAATTAATGGGTGTGAAGGTGTTTTCCACACAGCATCACCTGTTTCACCATTT
rJMSF029E08+ TTTCACCA-TT
                      ____________________________________________________________
consensus GATGATGCAATTAATGGGTGTGAAGGTGTTTTCCACACAGCATCACCTGTTTCACCATTT
 
. : . : . : . : . : . :
JMSF029E08- GCAACTAAGGGAGAACTAGTGGATCCTGCAGTAAAGGGGACACTTAATGTTCTTGGATCA
rJMSF029E08+ GCAACTAAGGGAGAACTAGTGGATCCTGCAGTAAAGGGGACACTTAATGTTCTTGGATCA
rJMSF016D11+ TGAATCA
                      ____________________________________________________________
consensus GCAACTAAGGGAGAACTAGTGGATCCTGCAGTAAAGGGGACACTTAATGTTCTTGGATCA
 
. : . : . : . : . : . :
JMSF029E08- TGTGTAAGAACACCTTCTGTGAAAAGGGTAGTGGTGACATCTTCAACGGCTTCAGTTATG
rJMSF029E08+ TGTGTAAGAACACCTTCTGTGAAAAGGGTAGTGGTGACATCTTCAACGGCTTCAGTTATG
rJMSF044N02+ G
rJMSF016D11+ TGTGTGAGAACACCTTCTGTGNAAAGAATAGTGCTGACGTCCTCAACGGCAACCATTATG
rJMFF015C24+ TCTGTGAAAAGAATAGTGCTGACGTCCTCAACGGCAACCATTATG
                      ____________________________________________________________
consensus TGTGTAAGAACACCTTCTGTGAAAAGGGTAGTGGTGACATCTTCAACGGCTTCAGTTATG
 
. : . : . : . : . : . :
JMSF029E08- TACAAATCAAATCCTATAAGTGCAACTGATGTAATCGACGAGAATTGGTTTTCTGATAAA
rJMSF029E08+ TACAAATCAAATCCTATAAGTGCAACTGATGTAATCGACGAGAATTGGTTTTCTGATAAA
rJMSF044N02+ TACAAACCAAATCCTATAAGTCCAACTGACGTAATCGATGACACTTGGTTTTCTGATAAA
rJMSF016D11+ TACAAACCAAATCCTATAAGTCCAACTGACGTAATCGATGACACTTGGTTTTCTGATAAA
rJMFF015C24+ TACAAACCAAATCCTATAAGTCCAACTGACGTAATCGATGACACTTGGTTTTCTGATAAA
rJMFF016A07+ ATAAA
                      ____________________________________________________________
consensus TACAAATCAAATCCTATAAGTGCAACTGATGTAATCGATGAGACTTGGTTTTCTGATAAA
 
. : . : . : . : . : . :
JMSF029E08- GAATTTGCAGAGGAAACAAAGCAATGGTATATTTTGTCTAAAGTCCTTGCCGAGGAAGCA
rJMSF029E08+ GAATTTGCAGAGGAAACAAAGCAATGGTATATTTTGTCTAAAGTCCTTGCCGAGGAAGCA
rJMSF044N02+ GAATTTGCAGAGGAAACAAAGCAATGGTATATCTTGTCTAAAGTCTTTGCTGAGGAAGCA
rJMSF038M03+ AGCAATGGTATATCTTGTCTAAAGTCTTTGCTGAGGAAGCA
rJMSF016D11+ GAATTTGCAGAGGAAACAAAGCAATGGTATATCTTGTCTAAAGTCTTTGCTGAGGAAGCA
rJMFF015C24+ GAATTTGCAGAGGAAACAAAGCAATGGTATATCTTGTCTAAAGTCTTTGCTGAGGAAGCA
rJMFF016A07+ GAATTTGCAGAGGAAACAAAGCAATGGTATATCTTGTCTAAAGTCTTTGCTGAGGAAGCA
                      ____________________________________________________________
consensus GAATTTGCAGAGGAAACAAAGCAATGGTATATCTTGTCTAAAGTCTTTGCTGAGGAAGCA
 
. : . : . : . : . : . :
JMSF029E08- GCATGGAAATACGCAGGGGAGAATATGATTGACATGGTTTCACTTCATCCTTGTCTTGTT
rJMSF029E08+ GCATGGAAATACGCAGGGGAGAATATGATTGACATGGTTTCACTTCATCCTTGTCTTGTT
rJMSF044N02+ GCATGGAAATATGCTGGGGAGAATAGGATCGACATGGTTTCACTGCACCCTGCTCTTGTT
rJMSF038M03+ GCATGGAAATATGCTGGGGAGAATAGGATCGACATGGTTTCACTGCACCCTGCTCTTGTT
rJMSF016D11+ GCATGGAAATATGCTGGGGAGAATAGGATCGACATGGTTTCACTGCACCCTGCTCTTGTT
rJMFF015C24+ GCATGGAAATATGCTGGGGAGAATAGGATCGACATGGTTTCACTGCACCCTGCTCTTGTT
rJMFF016A07+ GCATGGAAATATGCTGGGGAGAATAGGATCGACATGGTTTCACTGCACCCTGCTCTTGTT
                      ____________________________________________________________
consensus GCATGGAAATATGCTGGGGAGAATAGGATCGACATGGTTTCACTGCACCCTGCTCTTGTT
 
. : . : . : . : . : . :
JMSF029E08- ATAGGCCCTCTTTTACAACCAATTCTTAATTTTTCAAGTGAACTGATTCTGGACACC
rJMSF029E08+ ATAGGCCCTCTTTTACAACCAATTCTTAATTTTTCAAGTGAACTGATTCTGGACACCATA
rJMSF044N02+ ATTGGCCCTCTTTTACAACCAATTCTTAATTTTTCAAGTGAGATGATTCTGGACACCATA
rJMSF038M03+ ATTGGCCCTCTTTTACAACCAATTCTTAATTTTTCAAGTGAGATGATTCTGGACACCATA
rJMSF016D11+ ATTGGCCCTCTTTTACAACCAATTCTTAATTTTTCAAGTGAGATGATTCTGGACACCATA
rJMFF015C24+ ATTGGCCCTCTTTTACAACCAATTCTTAATTTTTCAAGTGAGATGATTCTGGACACCATA
rJMFF016A07+ ATTGGCCCTCTTTTACAACCAATTCTTAATTTTTCAAGTGAGATGATTCTGGACACCATA
                      ____________________________________________________________
consensus ATTGGCCCTCTTTTACAACCAATTCTTAATTTTTCAAGTGAGATGATTCTGGACACCATA
 
. : . : . : . : . : . :
rJMSF029E08+ AAAGAAGGAAAGGATTTCATGTTTTCTCCAGTCATGAATTGTTGTGTTGATGTTAGAGAC
rJMSF044N02+ AAAGAAGGAAGGGAGTTCATGTCTTCCCCATTC---AATTGCTATGTTGATGTTAGAGAC
rJMSF038M03+ AAAGAAGGAAGGGAGTTCATGTCTTCCCCATTC---AATTGCTATGTTGATGTTAGAGAC
rJMSF016D11+ AAAGAAGGAAGGGAGTTCATGTCTTCCCCATTC---AATTGCTATGTTGATGTTAGAGAC
rJMFF015C24+ AAAGAAGGAAGGGAGTTCATGTCTTCCCCATTC---AATTGCTATGTTGATGTTAGAGAC
rJMFF016A07+ AAAGAAGGAAGGGAGTTCATGTCTTCCCCATTC---AATTGCTATGTTGATGTTAGAGAC
                      ____________________________________________________________
consensus AAAGAAGGAAGGGAGTTCATGTCTTCCCCATTC---AATTGCTATGTTGATGTTAGAGAC
 
. : . : . : . : . : . :
rJMSF029E08+ GTCGCAAATGCACATATCCGAGCATTTGAGGTACCTTCCGCCAGTGGAAGATACTGTTTG
rJMSF044N02+ GTCGCAAATGCACATATCGAAGCATTTGAGGTACCTTCTGCCAGTGGAAGATACTGTTTG
rJMSF038M03+ GTCGCAAATGCACATATCGAAGCATTTGAGGTACCTTCTGCCAGTGGAAGATACTGTTTG
rJMSF016D11+ GTCGCAAATGCACATATCGAAGCATTTGAGGTACCTTCTGCCAGTGGAAGATACTGTTTG
rJMFF015C24+ GTCGCAAATGCACATATCGAAGCATTTGAGGTACCTTCTGCCAGTGGAAGATACTGTTTG
rJMFF016A07+ GTCGCAAATGCACATATCGAAGCATTTGAGGTACCTTCTGCCAGTGGAAGATACTGTTTG
                      ____________________________________________________________
consensus GTCGCAAATGCACATATCGAAGCATTTGAGGTACCTTCTGCCAGTGGAAGATACTGTTTG
 
. : . : . : . : . : . :
rJMSF029E08+ GTTGGGGAAACAGTGCACTTTTCTCAGGTTTTGAAGATTGTTGGCCAACTTTATCCCTCT
rJMSF044N02+ GTTGGGGAAACAATGCAGACTTCTGAGGTTTTGAAGATTGTTAGCCAGCTTTATCCCTCT
rJMSF038M03+ GTTGGGGAAACAATGCAGACTTCTGAGGTTTTGAAGATTGTTAGCCAGCTTTATCCCTCT
rJMSF016D11+ GTTGGGGAAACAATGCAGACTTCTGAGGTTTTGAAGATTGTTAGCCAGCTTTATCCCTCT
rJMFF015C24+ GTTGGGGAAACAATGCAGACTTCTGAGG-TTTGAAGATTGTTAGCCAGCTTTATCCCTCT
rJMFF016A07+ GTTGGGGAAACAATGCAGACTTCTGAGGTTTTGAAGATTGTTAGCCAGCTTTATCCCTCT
rJMFF049A17+ GAGGTTTTGAAGATTGTTAGCCAGCTTTATCCCTCT
rJMFF046J11+ TTTGAAGATTGTTAGCCAGCTTTATCCCTCT
                      ____________________________________________________________
consensus GTTGGGGAAACAATGCAGACTTCTGAGGTTTTGAAGATTGTTAGCCAGCTTTATCCCTCT
 
. : . : . : . : . : . :
rJMSF029E08+ CTTGTCATTCCTGCAGAGAAATCTAAAGGAGACTTGCCTATAGTGCCACCATTCAAAGTA
rJMSF044N02+ CTTCCCATTC---CCGAGAAATATAAAGGAGACTTGCCTATAATGCCAACATTCAAAGTA
rJMSF038M03+ CTTCCCATTC---CCGAGAAATATAAAGGAGACTTGCCTATAATGCCAACATTCAAAGTA
rJMSF016D11+ CTTCCCATTC---CCGAGAAATATAAAGGAGACTTGCCTATAATGCCAACATTCAAAGTA
rJMFF015C24+ CTTCCCATTC---CCGAGAAATATAAAGGAGACTTGCCTATAATGCCAACATTCAAAGTA
rJMFF016A07+ CTTCCCATTC---CCGAGAAATATAAAGGAGACTTGCCTATAATGCCAACATTCAAAGTA
rJMFF049A17+ CTTCCCATTC---CCGAGAAATATAAAGGAGACTTGCCTATAATGCCAACATTCAAAGTA
rJMFF046J11+ CTTCCCATTC---CCGAGAAATATAAAGGAGACTTGCCTATAATGCCAACATTCAAAGTA
                      ____________________________________________________________
consensus CTTCCCATTC---CCGAGAAATATAAAGGAGACTTGCCTATAATGCCAACATTCAAAGTA
 
. : . : . : . : . : . :
rJMSF029E08+ TCCCAGGACAAGGCCAAAAGCTTGGGTATCAACTTCACTTCTTTAGAAGTGAGCCTTAAG
rJMSF044N02+ TCCCAAGACAAGGCAAAAAGCTTGGGTATCAACTTCACTCCTTTAGAAGTGAGCCTTAAG
rJMSF038M03+ TCCCAAGACAAGGCAAAAAGCTTGGGTATCAACTTCACTCCTTTAGAAGTGAGCCTTAAG
rJMSF016D11+ TCCCAAGACAAGGCAAAAAGCTTGGGTATCAACTTCACTCCTTTAGAAGTGAGCCTTAAG
rJMFF015C24+ TCCCAAGACAAGGCAAAAAGCTTGGGTATCAACTTCACTCCTTTAGAAGTGAGCCTTAAG
rJMFF016A07+ TCCCAAGACAAGGCAAAAAGCTTGGGTATCAACTTCACTCCTTTAGAAGTGAGCCTTAAG
rJMFF049A17+ TCCCAAGACAAGGCAAAAAGCTTGGGTATCAACTTCACTCCTTTAGAAGTGAGCCTTAAG
rJMFF046J11+ TCCCAAGACAAGGCAAAAAGCTTGGGTATCAACTTCACTCCTTTAGAAGTGAGCCTTAAG
                      ____________________________________________________________
consensus TCCCAAGACAAGGCAAAAAGCTTGGGTATCAACTTCACTCCTTTAGAAGTGAGCCTTAAG
 
. : . : . : . : . : . :
rJMSF029E08+ GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTA
rJMSF044N02+ GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTACTTTGATTT
rJMSF038M03+ GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTACTTTGATTT
rJMSF016D11+ GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTACTTTGATTT
rJMFF015C24+ GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTACTTTGATTT
rJMFF016A07+ GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTACTTTGATTT
rJMFF049A17+ GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTACTTTGATTT
rJMFF046J11+ GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTACTTTGATTT
                      ____________________________________________________________
consensus GATACTATTGAAAGTTTAAAGGAGAAAAACTTCTTGAGCTTCTAGTTTTTACTTTGATTT
 
. : . : . : . : . : . :
rJMSF044N02+ GTCATGAAGCTCTGAAAACTATGAGCATAAAAGTTGTAAGGGAATGTCTTAGCTTTCCAT
rJMSF038M03+ GTCATGAAGCTCTGAAAACTATGAGCATAAAAGTTGTAAGGGAATGTCTTAGCTTTCCAT
rJMSF016D11+ GTCATGAAGCTCTGAAAACTATGAGCATAAAAGTTGTAAGGGAATGTCTTAGCTTTCCAT
rJMFF015C24+ GTCATGAAGCTCTGAAAACTATGAGCATAAAAGTTGTAAGGGAATGTCTTAGCTTTCCAT
rJMFF016A07+ GTCATGAAGCTCTGAAAACTATGAGCATAAAAGTTGTAAGGGAATGTCTTAGCTTTCCAT
rJMFF049A17+ GTCATGAAGCTCTGAAAACTATGAGCATAAAAGTTGTAAGGGAATGTCTTAGCTTTCCAT
rJMFF046J11+ GTCATGAAGCTCTGAAAACTATGAGCATAAAAGTTGTAAGGGAATGTCTTAGCTTTCCAT
                      ____________________________________________________________
consensus GTCATGAAGCTCTGAAAACTATGAGCATAAAAGTTGTAAGGGAATGTCTTAGCTTTCCAT
 
. : . : . : . : . : . :
rJMSF044N02+ TGACTATTGAACCACTTTCAAACAGTGGTAA-CTGATTGCTACGTACT
rJMSF038M03+ TGACTATTGAACCACTTTCAAACAGTGGTAA-CTGATTGCTACGTACT
rJMSF016D11+ TGACTATTGAACCACTTTCAANCAGTGGTAACCTGATTGCTACGTACTGT
rJMFF015C24+ TGACTATTGAACCACTTTCAA-CAGTGGTAA-CTGATTGCTACGTACTGTTCCTTCTTTC
rJMFF016A07+ TGACTATTGAACCACTTTCAA-CAGTGGTAA-CTGATTGCTACGTACTGTTCCTTCTTTC
rJMFF049A17+ TGACTATTGAACCACTTTCAA-CAGTGGTAA-CTGATTGCTACGTACTGTTCCTTCTTTC
rJMFF046J11+ TGACTATTGAACCACTTTCAA-CAGTGGTAA-CTGATTGCTACGTACTGTTCCTTCTTTC
                      ____________________________________________________________
consensus TGACTATTGAACCACTTTCAAACAGTGGTAA-CTGATTGCTACGTACTGTTCCTTCTTTC
 
. : . : . : . : . : . :
rJMFF015C24+ CTCGGATT
rJMFF016A07+ CTCGGATTGTTAAATAAAATTGTTTACTCCATCGTAACAAAAATAATGTAAACAT
rJMFF049A17+ CTCGGATTGTTAAATAAAATTGTTTACTCCATCGTAACAAAAATAATGTAAACATTGAAT
rJMFF046J11+ CTCGGATTGTTAAATAAAATTGTTTACTCCATCGTAACAAAAATAATGTAAACATTGAAT
                      ____________________________________________________________
consensus CTCGGATTGTTAAATAAAATTGTTTACTCCATCGTAACAAAAATAATGTAAACATTGAAT
 
. : . : . : . : . : . :
rJMFF049A17+ GTTTTTATTCCATCGTAACATATAAGAAGATTAGAAAAAAAAAAAAAAACTCTCCAGGGT
rJMFF046J11+ GTTTTTATTCCATCGTAACATATAAGAAGATTAGAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus GTTTTTATTCCATCGTAACATATAAGAAGATTAGAAAAAAAAAAAAAAACTCTCCAGGGT