Previous Contig 010649:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021E05Sequence417001069 (2)gb:AY054669_15633234e-20Arabidopsis thaliana sedoheptulose-bisphosphatase precursor (At3g55800; F1I16_21694010649 (2)gb:OSJN00246_16973172e-54Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042F21, complete seque
JMFF046I12Sequence519001069 (2)gb:AY054669_15633234e-39Arabidopsis thaliana sedoheptulose-bisphosphatase precursor (At3g55800; F1I16_21529010649 (2)gb:OSJN00246_16973171e-14Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042F21, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF021E05+ CAATGCTGACTATGCTAAGCTAATTGACTACTA
                      ____________________________________________________________
consensus CAATGCTGACTATGCTAAGCTAATTGACTACTA
 
. : . : . : . : . : . :
rJMFF021E05+ TGTTAGGGAGAAGTACACCCTGAGATACACCGGAGGAATGGTGCCTGATGTAAACCAGAT
                      ____________________________________________________________
consensus TGTTAGGGAGAAGTACACCCTGAGATACACCGGAGGAATGGTGCCTGATGTAAACCAGAT
 
. : . : . : . : . : . :
rJMFF021E05+ CATTGTGAAAGAGAAGGGAATTTTCACAAATGTGGTATCCCCATCAGCCAAGGCCAAGTT
                      ____________________________________________________________
consensus CATTGTGAAAGAGAAGGGAATTTTCACAAATGTGGTATCCCCATCAGCCAAGGCCAAGTT
 
. : . : . : . : . : . :
rJMFF021E05+ GAGGCTGCTCTTCGAGGTGGCTCCATTGGGGTTCTTGATTGAGAAAGCCGGGGGGTATAG
                      ____________________________________________________________
consensus GAGGCTGCTCTTCGAGGTGGCTCCATTGGGGTTCTTGATTGAGAAAGCCGGGGGGTATAG
 
. : . : . : . : . : . :
rJMFF021E05+ CAGTGACGGGGAAAAGTCTGTGCTTGACAAGGTGATCACTAATCTTGACGACAGGACTCA
rJMFF046I12+ AGTCTGTGCTTGACAAGGTGATCACTAATCTTGACGACAGGACTCA
                      ____________________________________________________________
consensus CAGTGACGGGGAAAAGTCTGTGCTTGACAAGGTGATCACTAATCTTGACGACAGGACTCA
 
. : . : . : . : . : . :
rJMFF021E05+ AGTGGCTTATGGTTCCAAGAACGAGATTATCCGATTCGAGGAGACACTCTATGGATCCTC
rJMFF046I12+ AGTGGCTTATGGTTCCAAGAACGAGATTATCCGATTCGAGGAGACACTCTATGGATCCTC
                      ____________________________________________________________
consensus AGTGGCTTATGGTTCCAAGAACGAGATTATCCGATTCGAGGAGACACTCTATGGATCCTC
 
. : . : . : . : . : . :
rJMFF021E05+ CAGGCTTAAGGCTGCTGAGCCAGTTGGAGCTGCCGCTTAAGTTAAGCATGACTGTCCGAG
rJMFF046I12+ CAGGCTTAAGGCTGCTGAGCCAGTTGGAGCTGCCGCTTAAGTTAAGCATGACTGTCCGAG
                      ____________________________________________________________
consensus CAGGCTTAAGGCTGCTGAGCCAGTTGGAGCTGCCGCTTAAGTTAAGCATGACTGTCCGAG
 
. : . : . : . : . : . :
rJMFF021E05+ CCATTTCGCCCTCGTAACGTTTTGGTTTGTTTGTAAAACAACATTTACCTCAATGCTTTT
rJMFF046I12+ CCATTTCGCCCTCGTAACGTTTTGGTTTGTTTGTAAAACAACATTTACCTCAATGCTTTT
                      ____________________________________________________________
consensus CCATTTCGCCCTCGTAACGTTTTGGTTTGTTTGTAAAACAACATTTACCTCAATGCTTTT
 
. : . : . : . : . : . :
rJMFF021E05+ GATTTGGAGTACCTACAGTGGTAGCACATAGTCACAGGGTTCTAGATTCTGCTGAAATAA
rJMFF046I12+ GATTTGGAGTACCTACAGTGGTAGCACATAGTCACAGGGTTCTAGATTCTGCTGAAATAA
                      ____________________________________________________________
consensus GATTTGGAGTACCTACAGTGGTAGCACATAGTCACAGGGTTCTAGATTCTGCTGAAATAA
 
. : . : . : . : . : . :
rJMFF021E05+ AGAATCGAGCCATTTATTTATGGTGTTTTTTGTTTTCTTCTTCTTCTTCTTCTTCTGGGA
rJMFF046I12+ AGAATCGAGCCATTTATTTATGGTGTTTTTTGTTTTCTTCTTCTTCTTCTTCTTCTGGGA
                      ____________________________________________________________
consensus AGAATCGAGCCATTTATTTATGGTGTTTTTTGTTTTCTTCTTCTTCTTCTTCTTCTGGGA
 
. : . : . : . : . : . :
rJMFF021E05+ TAAATTAATCCAATGAAGTCTTTTCTTGATCTTCTCTACCCAAGAAAACAATTTTGGATG
rJMFF046I12+ TAAATTAATCCAATGAAGTCTTTTCTTGATCTTCTCTACCCAAGAAAACAATTTTGGATG
                      ____________________________________________________________
consensus TAAATTAATCCAATGAAGTCTTTTCTTGATCTTCTCTACCCAAGAAAACAATTTTGGATG
 
. : . : . : . : . : . :
rJMFF021E05+ GACAAGTATGCTCTGCTGCTTCTAGATGCCACCTAGAATTTAGCCTTCTGGAAATGTATT
rJMFF046I12+ GACAAGTATGCTCTGCTGCTTCTAGATGCCACCTAGAATTTAGCCTTCTGGAAATGTATT
                      ____________________________________________________________
consensus GACAAGTATGCTCTGCTGCTTCTAGATGCCACCTAGAATTTAGCCTTCTGGAAATGTATT
 
. : . : . : . : . : . :
rJMFF021E05+ A
rJMFF046I12+ ATGTTCTTAATGAATGGTTAAGATCAGCAAACCAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus ATGTTCTTAATGAATGGTTAAGATCAGCAAACCAAAAAAAAAAAAAAAACTCTCCAGGGT