Previous Contig 010648:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011F11Sequence521001988 (4)pir|T51477|T514772e-30glutamine-rich protein - Arabidopsis thaliana>gb:ATK3M16_1553524 Arabidopsis tha727010648 (4)pir|T51477|T514771e-29glutamine-rich protein - Arabidopsis thaliana>gb:ATK3M16_1553524 Arabidopsis tha
JMFF019I24Sequence493001988 (4)pir|T51477|T514778e-27glutamine-rich protein - Arabidopsis thaliana>gb:ATK3M16_1553524 Arabidopsis tha176010648 (4)
JMFF040L22Sequence495001988 (4)pir|T51477|T514775e-26glutamine-rich protein - Arabidopsis thaliana>gb:ATK3M16_1553524 Arabidopsis tha739010648 (4)pir|T51477|T514772e-35glutamine-rich protein - Arabidopsis thaliana>gb:ATK3M16_1553524 Arabidopsis tha
JMFF046I05Sequence634001988 (4)pir|T51477|T514772e-27glutamine-rich protein - Arabidopsis thaliana>gb:ATK3M16_1553524 Arabidopsis tha604010648 (4)pir|T51477|T514771e-18glutamine-rich protein - Arabidopsis thaliana>gb:ATK3M16_1553524 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040L22+ TACTGCGACATTTGAGAAACAAGTACTCGCA
                      ____________________________________________________________
consensus TACTGCGACATTTGAGAAACAAGTACTCGCA
 
. : . : . : . : . : . :
rJMFF040L22+ TTTAATATAATTTCGAGGAAAAGAGAACAAGGGGAATTCCGGACAGAGGAGAAACTGCAA
rJMFF011F11+ AATATAATTTCGAGGAAAAGAGAACAAGGGGAATTCCGGACAGAGGAGAAACTGCAA
                      ____________________________________________________________
consensus TTTAATATAATTTCGAGGAAAAGAGAACAAGGGGAATTCCGGACAGAGGAGAAACTGCAA
 
. : . : . : . : . : . :
rJMFF040L22+ ATCGAGCAGATGCTAGTGCAAGAAGAGAAGTTGGCATTCTCTGAAATGATGGACATGAGG
rJMFF011F11+ ATCGAGCAGATGCTAGTGCAAGAAGAGAAGTTGGCATTCTCTGAAATGATGGACATGAGG
                      ____________________________________________________________
consensus ATCGAGCAGATGCTAGTGCAAGAAGAGAAGTTGGCATTCTCTGAAATGATGGACATGAGG
 
. : . : . : . : . : . :
rJMFF040L22+ CAGAAGGCAGGGCGGGAGAGTCATGAAGCTAATATGCAAATGGCAGCTATGGTTCAAGCG
rJMFF011F11+ CAGAAGGCAGGGCGGGAGAGTCATGAAGCTAATATGCAAATGGCAGCTATGGTTCAAGCG
rJMFF046I05+ CAAGCG
                      ____________________________________________________________
consensus CAGAAGGCAGGGCGGGAGAGTCATGAAGCTAATATGCAAATGGCAGCTATGGTTCAAGCG
 
. : . : . : . : . : . :
rJMFF040L22+ GAGCAGGCTCGAGCGGAATCTCAAGCGCGTGCTGAGATGATGTCCCGAGGACCAATTCGA
rJMFF011F11+ GAGCAGGCTCGAGCGGAATCTCAAGCGCGTGCTGAGATGATGTCCCGAGGACCAATTCGA
rJMFF046I05+ GAGCAGGCTCGAGCGGAATCTCAAGCGCGTGCTGAGATGATGTCCCGAGGACCAATTCGA
                      ____________________________________________________________
consensus GAGCAGGCTCGAGCGGAATCTCAAGCGCGTGCTGAGATGATGTCCCGAGGACCAATTCGA
 
. : . : . : . : . : . :
rJMFF040L22+ GCAAGTGCACTTGGGCCTCGAGGCGGCAATATTCTGATGGGTCATGATGGTGGGGAGCAA
rJMFF011F11+ GCAAGTGCACTTGGGCCTCGAGGCGGCAATATTCTGATGGGTCATGATGGTGGGGAGCAA
rJMFF046I05+ GCAAGTGCACTTGGGCCTCGAGGCGGCAATATTCTGATGGGTCATGATGGTGGGGAGCAA
                      ____________________________________________________________
consensus GCAAGTGCACTTGGGCCTCGAGGCGGCAATATTCTGATGGGTCATGATGGTGGGGAGCAA
 
. : . : . : . : . : . :
rJMFF040L22+ GTGCAGGAAGTGAAAGATGAAGAAATGATGAATGGTTGGGGTAACAACACACAGAAGGAT
rJMFF011F11+ GTGCAGGAAGTGAAAGATGAAGAAATGATGAATGGTTGGGGTAACAACACACAGAAGGAT
rJMFF046I05+ GTGCAGGAAGTGAAAGATGAAGAAATGATGAATGGTTGGGGTAACAACACACAGAAGGAT
                      ____________________________________________________________
consensus GTGCAGGAAGTGAAAGATGAAGAAATGATGAATGGTTGGGGTAACAACACACAGAAGGAT
 
. : . : . : . : . : . :
rJMFF040L22+ GAAAAGGAGCCTTCAGAGGATTTTCTGAATGATGAAGAAACAGAGAATGGAGAAGGTGGT
rJMFF011F11+ GAAAAGGAGCCTTCAGAGGATTTTCTGAATGATGAAGAAACAGAGAATGGAGAAGGTGGT
rJMFF046I05+ GAAAAGGAGCCTTCAGAGGATTTTCTGAATGATGAAGAAACAGAGAATGGAGAAGGTGGT
                      ____________________________________________________________
consensus GAAAAGGAGCCTTCAGAGGATTTTCTGAATGATGAAGAAACAGAGAATGGAGAAGGTGGT
 
. : . : . : . : . : . :
rJMFF040L22+ GGTGGTATTCAGAGCGACTGGCGTGGAGGGGGAGAGTTGGATCTCAACACAAGATGAATC
rJMFF011F11+ GGTGGTATTCAGAGCGACTGGCGTGGAGGGGGAGAGTTGGATCTCAACACAAGATGAATC
rJMFF046I05+ GGTGGTATTCAGAGCGACTGGCGTGGAGGGGGAGAGTTGGATCTCAACACAAGATGAATC
                      ____________________________________________________________
consensus GGTGGTATTCAGAGCGACTGGCGTGGAGGGGGAGAGTTGGATCTCAACACAAGATGAATC
 
. : . : . : . : . : . :
rJMFF040L22+ AATATGAATCTTTACAAGCAGAGGCATAGACAGTTGGCTGGCTTGTGTACCAACTACCAA
rJMFF011F11+ AATATGAATCTTTACAAGCAGAGGCATAGACAGTTGGCTGGCTTGTGTACCAACTACCAA
rJMFF046I05+ AATATGAATCTTTACAAGCAGAGGCATAGACAGTTGGCTGGCTTGTGTACCAACTACCAA
                      ____________________________________________________________
consensus AATATGAATCTTTACAAGCAGAGGCATAGACAGTTGGCTGGCTTGTGTACCAACTACCAA
 
. : . : . : . : . : . :
rJMFF040L22+ CTACCAGGGAAGAAGAAGCAGCAAGAGAAACGTTACAGTTACACTCCCTTTTAACTTGTT
rJMFF019I24+ TACCAGGGAAGAAGAAGCAGCAAGAGAAACGTTACAGTTACACTCCCTTTTANCTTGTT
rJMFF011F11+ CTACCAGGGAAGAAGAAGCAGCAAGAGAAACGTTACAGTTACACTCCCTTTTAACTTGTT
rJMFF046I05+ CTACCAGGGAAGAAGAAGCAGCAAGAGAAACGTTACAGTTACACTCCCTTTTAACTTGTT
                      ____________________________________________________________
consensus CTACCAGGGAAGAAGAAGCAGCAAGAGAAACGTTACAGTTACACTCCCTTTTAACTTGTT
 
. : . : . : . : . : . :
rJMFF040L22+ ATGATATGATTTTTGTGTCAGGGATTGTTGTGTTGTACAGAAGCTGTACCTTCAAATCAT
rJMFF019I24+ ATGATATGATTTTTGTGTCAGGGATTGTTGTGTTGTACAGAAGCTGTACCTTCAAATCAT
rJMFF011F11+ ATGATATGATTTTTGTGTCAGGGATTGTTGTGTTGTACAGAAGCTGTACCTTCAAATCAT
rJMFF046I05+ ATGATATGATTTTTGTGTCAGGGATTGTTGTGTTGTACAGAAGCTGTACCTTCAAATCAT
                      ____________________________________________________________
consensus ATGATATGATTTTTGTGTCAGGGATTGTTGTGTTGTACAGAAGCTGTACCTTCAAATCAT
 
. : . : . : . : . : . :
rJMFF040L22+ CTCTTCAATTGTACTCTTACTAGGCACAAATTTTTAGGGAAAT
rJMFF019I24+ CTCTTCAATTGTACTCTTACTAGGCACAAATTTTTAGGGAAATGCAGAATCTATCTC
rJMFF011F11+ CTCTTCAATTGTACTCTTACTAGGCACAAATTTTTAGGGAAATGCAGAATCTATCTCCAA
rJMFF046I05+ CTCTTCAATTGTACTCTTACTAGGC--AAATTTTTAGGGAAATGCAGAATCTATCTCCAA
                      ____________________________________________________________
consensus CTCTTCAATTGTACTCTTACTAGGCACAAATTTTTAGGGAAATGCAGAATCTATCTCCAA
 
. : . : . : . : . : . :
rJMFF011F11+ TTGCTCTAAT
rJMFF046I05+ TTGCTCTAATTAATGATTGAAAATAACTCGGTCGAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TTGCTCTAATTAATGATTGAAAATAACTCGGTCGAAAAAAAAAAAAAAACTCTCCAGGGT