Previous Contig 010643:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046H02Sequence553001986 (3)gb:AY303171_15974204e-80Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence.458010643 (3)gb:AY303171_15974205e-33Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence.
JMFS069C08Sequence213010643 (3)
JMFS138E11Sequence613010643 (3)gb:AY303171_15974205e-71Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS138E11+ TTTCATGGGCCCGACATTCTACCAGCGGCTTACGCATATGGCT
                      ____________________________________________________________
consensus TTTCATGGGCCCGACATTCTACCAGCGGCTTACGCATATGGCT
 
. : . : . : . : . : . :
JMFS138E11+ GAGGACAAAGTGAAGTTCCGCAACACGGGCCCAGTCCATCCCCTTACCCCCCAACCCGTG
                      ____________________________________________________________
consensus GAGGACAAAGTGAAGTTCCGCAACACGGGCCCAGTCCATCCCCTTACCCCCCAACCCGTG
 
. : . : . : . : . : . :
JMFS138E11+ GCTGACAGGAAACGCTTTGGTGGTATCAAATTCGGTGAGATGGAGCGCGACTGTCTCATA
                      ____________________________________________________________
consensus GCTGACAGGAAACGCTTTGGTGGTATCAAATTCGGTGAGATGGAGCGCGACTGTCTCATA
 
. : . : . : . : . : . :
JMFS138E11+ GCACACGGTGCTGCTGCAAACCTGCACGAGCGACTCTTCACACTCAGTGATTCCTCCCAG
rJMFF046H02+ TGCACGAGCGACTCTTCACACTCAGTGATTCCTCCCAG
                      ____________________________________________________________
consensus GCACACGGTGCTGCTGCAAACCTGCACGAGCGACTCTTCACACTCAGTGATTCCTCCCAG
 
. : . : . : . : . : . :
JMFS138E11+ ATGCACATATGTAGAAAGTGCAAGAACATGGCCAATGTGATCCAACGGCCCGTGCTTGGT
rJMFF046H02+ ATGCACATATGTAGAAAGTGCAAGAACATGGCCAATGTGATCCAACGGCCCGTGCTTGGT
                      ____________________________________________________________
consensus ATGCACATATGTAGAAAGTGCAAGAACATGGCCAATGTGATCCAACGGCCCGTGCTTGGT
 
. : . : . : . : . : . :
JMFS138E11+ GGGCGTAAGGTTAGGGGTCCCTACTGTCGTTTCTGTGAATCAGTAGAAGATATCGTGAAG
rJMFF046H02+ GGGCGTAAGGTTAGGGTTCCCTACTGTCGTTTCTGTGAATCAGTAGAAGATATCGTGAAG
                      ____________________________________________________________
consensus GGGCGTAAGGTTAGGGTTCCCTACTGTCGTTTCTGTGAATCAGTAGAAGATATCGTGAAG
 
. : . : . : . : . : . :
JMFS138E11+ GTGAATGTGCCATACGGGGCGAAGCTGTTGTGTCAAGAGCTCTTCAGTATGGGGCTGTCT
rJMFF046H02+ GTGAATGTGCCATACGGGGCGAAGCTGTTGTGTCAAGAGCTCTTCAGTATGGGGCTGTCT
                      ____________________________________________________________
consensus GTGAATGTGCCATACGGGGCGAAGCTGTTGTGTCAAGAGCTCTTCAGTATGGGGCTGTCT
 
. : . : . : . : . : . :
JMFS138E11+ TTGAAATTTGACACAGAAATTTCTTAAGATGTGTGTAGATTTAAGGATTGTGGAATAAGT
JMFS069C08+ TTAAGATGTGTGTAGATTTAAGGATTGTGGAATAAGT
rJMFF046H02+ TTGAAATTTGACACAGAAATTTCTTAAGATGTGTGTAGATTTAAGGATTGTGGAATAAGT
                      ____________________________________________________________
consensus TTGAAATTTGACACAGAAATTTCTTAAGATGTGTGTAGATTTAAGGATTGTGGAATAAGT
 
. : . : . : . : . : . :
JMFS138E11+ GTAGGGTAAAACTTGTCCAGGTGAACAACCTTTTGAAACATTGTGATCTCTCTCCCCTAG
JMFS069C08+ GTAGGGTAAAACTTGTCCAGGTGAACAACCTTTTGAAACATTGTGATCTCTCTCCCCTAG
rJMFF046H02+ GTAGGGTAAAACTTGTCCAGGTGAACAACCTTTTGAAACATTGTGATCTCTCTCCCCTAG
                      ____________________________________________________________
consensus GTAGGGTAAAACTTGTCCAGGTGAACAACCTTTTGAAACATTGTGATCTCTCTCCCCTAG
 
. : . : . : . : . : . :
JMFS138E11+ TTTGTCGCGCACAACATTAAAATGCTGTGTTTATTCTGATTCTGTTTTGGTTTTTGAA
JMFS069C08+ TTTGTCGCGCACAACATTAAAATGCTGTGTTTATTCTGATTCTGTTTTGGTTTTTGAATG
rJMFF046H02+ TTTGTCGCGCACAACATTAAAATGCTGTGTTTATTCTGATTCTGTTTTGGTTTTTGAATG
                      ____________________________________________________________
consensus TTTGTCGCGCACAACATTAAAATGCTGTGTTTATTCTGATTCTGTTTTGGTTTTTGAATG
 
. : . : . : . : . : . :
JMFS069C08+ AATGCAGTGTTTTTG
rJMFF046H02+ AATGCAGTGTTTTTGAAAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AATGCAGTGTTTTTGAAAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG