Previous Contig 010642:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046G13Sequence649001983 (2)gb:AY248907_1592642e-106Nicotiana tabacum EIL5 mRNA, complete cds.558010642 (3)gb:AY248907_15926424e-04Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF048O03Sequence514001983 (2)gb:AY248907_15926423e-83Nicotiana tabacum EIL5 mRNA, complete cds.502010642 (3)gb:AY248907_15926423e-04Nicotiana tabacum EIL5 mRNA, complete cds.
JMSF015J03Sequence242018937gb:AF328786_17869138e-16Lycopersicon esculentum EIL3 (EIL3) mRNA, complete cds.736010642 (3)gb:AY248907_15926425e-16Nicotiana tabacum EIL5 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015J03+ CAAAACCTTGGCACGCTAAA
                      ____________________________________________________________
consensus CAAAACCTTGGCACGCTAAA
 
. : . : . : . : . : . :
rJMSF015J03+ CTACCAAGTAAATAATAGCAAACAAGCAGTTTACTCATCGATGGCGCCCAAACCACCTGG
                      ____________________________________________________________
consensus CTACCAAGTAAATAATAGCAAACAAGCAGTTTACTCATCGATGGCGCCCAAACCACCTGG
 
. : . : . : . : . : . :
rJMSF015J03+ TGCATCAGCGATATCTTCCTCGCCCATGGACGTTTCTACCCTTGGACTACCCGAAGACGA
                      ____________________________________________________________
consensus TGCATCAGCGATATCTTCCTCGCCCATGGACGTTTCTACCCTTGGACTACCCGAAGACGA
 
. : . : . : . : . : . :
rJMSF015J03+ CGAAAGGGCGATTTCTGAACTTCTGTCGTTTTATGATAACAATCTTCAACAAAACGGAGG
                      ____________________________________________________________
consensus CGAAAGGGCGATTTCTGAACTTCTGTCGTTTTATGATAACAATCTTCAACAAAACGGAGG
 
. : . : . : . : . : . :
rJMSF015J03+ CTTCAATTCCGGGAATCTTAATAATGGCGTTGAACTTCACGTGGAAGACTACTTCTCAAC
rJMFF046G13+ GGAAGACTACTTCTCAAC
                      ____________________________________________________________
consensus CTTCAATTCCGGGAATCTTAATAATGGCGTTGAACTTCACGTGGAAGACTACTTCTCAAC
 
. : . : . : . : . : . :
rJMSF015J03+ TGCGGGAGGTGGAGTGTTTCAGCCGCAAGCAAATATGCCCGTGACTCACTCGGTTTTGCC
rJMFF048O03+ GAGTGTNTCAGCCGCAAGCAAATATGCCCGTGACTCACTCGGTTTTGCC
rJMFF046G13+ TGCGGGAGGTGGAGTGTTTCAGCCGCAAGCAAATATGCCCGTGACTCACTCGGTTTTGCC
                      ____________________________________________________________
consensus TGCGGGAGGTGGAGTGTTTCAGCCGCAAGCAAATATGCCCGTGACTCACTCGGTTTTGCC
 
. : . : . : . : . : . :
rJMSF015J03+ ATCAACTGGAACCCAATATGAATCTGGCTTCAATAGGAACTCGAGCGATATTGGTGATTT
rJMFF048O03+ ATCAACTGGAACCCAATATGAATCTGGCTTCAATAGGAACTCGAGCGATATTGGTGATTT
rJMFF046G13+ ATCAACTGGAACCCAATATGAATCTGGCTTCAATAGGAACTCGAGCGATATTGGTGATTT
                      ____________________________________________________________
consensus ATCAACTGGAACCCAATATGAATCTGGCTTCAATAGGAACTCGAGCGATATTGGTGATTT
 
. : . : . : . : . : . :
rJMSF015J03+ TAAGTTCGGTTCCTCGTGCAATTTGGTTGATTATTCAACGGATCAGCTTCCGAAGCAGGA
rJMFF048O03+ TAAGTTCGGTTCCTCGTGCAATTTGGTTGATTATTCAACGGATCAGCTTCCGAAGCAGGA
rJMFF046G13+ TAAGTTCGGTTCCTCGTGCAATTTGGTTGATTATTCAACGGATCAGCTTCCGAAGCAGGA
                      ____________________________________________________________
consensus TAAGTTCGGTTCCTCGTGCAATTTGGTTGATTATTCAACGGATCAGCTTCCGAAGCAGGA
 
. : . : . : . : . : . :
rJMSF015J03+ TGGATCCACATGGTACTTCTGAAACCAGGTAGGATCTATCCAATTGCTCCAAAGGAATCA
rJMFF048O03+ TGGATCCACATGGTACTTCTGAAACCAGGTAGGATCTATCCAATTGCTCCAAAGGAATCA
rJMFF046G13+ TGGATCCACATGGTACTTCTGAAACCAGGTAGGATCTATCCAATTGCTCCAAAGGAATCA
                      ____________________________________________________________
consensus TGGATCCACATGGTACTTCTGAAACCAGGTAGGATCTATCCAATTGCTCCAAAGGAATCA
 
. : . : . : . : . : . :
rJMSF015J03+ CCAATGCCTTAACTTTAAATAACTGTCGTAGATGTTAAAATACCGTACCATATGAAACTC
rJMFF048O03+ CCAATGCCTTAACTTTAAATAACTGTCGTAGATGTTAAAATACCGTACCATATGAAACTC
rJMFF046G13+ CCAATGCCTTAACTTTAAATAACTGTCGTAGATGTTAAAATACCGTACCATATGAAACTC
                      ____________________________________________________________
consensus CCAATGCCTTAACTTTAAATAACTGTCGTAGATGTTAAAATACCGTACCATATGAAACTC
 
. : . : . : . : . : . :
rJMSF015J03+ CTATCGAGCCTATATATGCTGCAAAACCTTTTATGTAGTTTTGGAACTATATATATATAT
rJMFF048O03+ CTATCGAGCCTATATATGCTGCAAAACCTTTTATGTAGTTTTGGAACTATATATATATAT
rJMFF046G13+ CTATCGAGCCTATATATGCTGCAAAACCTTTTATGTAGTTTTGGAACTATATATATATAT
                      ____________________________________________________________
consensus CTATCGAGCCTATATATGCTGCAAAACCTTTTATGTAGTTTTGGAACTATATATATATAT
 
. : . : . : . : . : . :
rJMSF015J03+ ATATAATTGATGAACTATATATCAAAATGGGCAAAGAGCTCTGATCTGAAGATGACAACC
rJMFF048O03+ ATATAATTGATGAACTATATATCAAAATGGGCAAAGAGCTCTGATCTGAAGATGACAACC
rJMFF046G13+ ATATAATTGATGAACTATATATCAAAATGGGCAAAGAGCTCTGATCTGAAGATGACAACC
                      ____________________________________________________________
consensus ATATAATTGATGAACTATATATCAAAATGGGCAAAGAGCTCTGATCTGAAGATGACAACC
 
. : . : . : . : . : . :
rJMSF015J03+ TTGCTCTCTTCCCCTCTTGTCCTTGTTGTTCTTAGGATGTACTTTTGT
rJMFF048O03+ TTGCTCTCTTCCCCTCTTGTCCTTGTTGTTCTTAGGATGTACTTTTGTTATCTCAATATC
rJMFF046G13+ TTGCTCTCTTCCCCTCTTGTCCTTGTTGTTCTTAGGATGTACTTTTGTTATCTCAATATC
                      ____________________________________________________________
consensus TTGCTCTCTTCCCCTCTTGTCCTTGTTGTTCTTAGGATGTACTTTTGTTATCTCAATATC
 
. : . : . : . : . : . :
rJMFF048O03+ AATATCAATGTATATTATACTTGATTAAGATGC
rJMFF046G13+ AATATCAATGTATATTATACTTGATTAAGATGCAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus AATATCAATGTATATTATACTTGATTAAGATGCAAAAAAAAAAAAAAAACTCTCCAGGGT