Previous Contig 010641:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002A15Sequence441002098 (27)pir|G96669|G966693e-38protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi728010641 (24)pir|G96669|G966692e-41protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF006I11Sequence593002098 (27)pir|G96669|G966692e-61protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi759010641 (24)pir|G96669|G966691e-46protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF018E02Sequence592002098 (27)pir|G96669|G966691e-55protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi620010641 (24)pir|G96669|G966695e-26protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF019G01Sequence583002098 (27)pir|G96669|G966692e-59protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi739010641 (24)gb:AB040741_15196395e-73Oryza sativa RRJ1 mRNA, patial cds.
JMFF023C21Sequence569002098 (27)pir|G96669|G966691e-55protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi730010641 (24)pir|G96669|G966697e-40protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF024N02Sequence590002098 (27)pir|G96669|G966691e-62protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi746010641 (24)pir|G96669|G966694e-42protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF025B18Sequence586002098 (27)pir|G96669|G966693e-60protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi778010641 (24)pir|G96669|G966693e-72protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF025N01Sequence591002098 (27)pir|G96669|G966692e-61protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi672010641 (24)pir|G96669|G966691e-34protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF027C20Sequence520002098 (27)pir|G96669|G966692e-48protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi724010641 (24)pir|G96669|G966696e-46protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF027J05Sequence407002098 (27)pir|G96669|G966699e-32protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi413010641 (24)gb:AB040741_15196393e-04Oryza sativa RRJ1 mRNA, patial cds.
JMFF030M09Sequence449002098 (27)pir|G96669|G966696e-38protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi672010641 (24)pir|G96669|G966693e-35protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF032C01Sequence492002098 (27)pir|G96669|G966694e-44protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi684010641 (24)pir|G96669|G966692e-34protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF034K21Sequence594002098 (27)pir|G96669|G966697e-47protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi734010641 (24)gb:AB040741_15196397e-75Oryza sativa RRJ1 mRNA, patial cds.
JMFF039N14Sequence405002098 (27)pir|G96669|G966692e-25protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi747010641 (24)pir|G96669|G966694e-66protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF045C06Sequence651002098 (27)pir|G96669|G966694e-66protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi635010641 (24)pir|G96669|G966699e-43protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF046G07Sequence607002098 (27)pir|G96669|G966698e-59protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi575010641 (24)gb:AB040741_15196396e-15Oryza sativa RRJ1 mRNA, patial cds.
JMFF049A03Sequence458002098 (27)gb:AE016959_10234492e-19Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02521010641 (24)pir|G96669|G966694e-34protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF049J05Sequence601002098 (27)pir|G96669|G966691e-62protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi612010641 (24)pir|G96669|G966692e-40protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFS041H02Sequence226010641 (24)
JMFS107H06Sequence623010641 (24)gb:AB040741_15196391e-64Oryza sativa RRJ1 mRNA, patial cds.
JMSF032E21Sequence630002098 (27)pir|G96669|G966699e-64protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi702010641 (24)pir|G96669|G966695e-40protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMSF041K17Sequence786002098 (27)pir|G96669|G966691e-90protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi732010641 (24)pir|G96669|G966695e-38protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMSF044D17Sequence663002098 (27)pir|G96669|G966695e-70protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi751010641 (24)pir|G96669|G966699e-83protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMSF045D17Sequence102002098 (27)733010641 (24)pir|G96669|G966697e-74protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044D17+ CCGATGGTCCTGTCGCCGGCC
                      ____________________________________________________________
consensus CCGATGGTCCTGTCGCCGGCC
 
. : . : . : . : . : . :
rJMSF045D17+ GGGCGCCGACGTCGTGGTTTCACAGCGTCTNCAAGTTCATCAGTGGCGGGGCCGA
rJMSF044D17+ AAATTGGGCGCCGACGTCGTGG-TTCACAGCGTCTCCAAGTTCATCAGTGGCGGGGCCGA
rJMFF034K21+ TTCACAGCGTCTCCAAGTTCATCAGTGGCGGGGCCGA
rJMFF019G01+ GTCTCCAAGTTCATCAGTGGCGGGGCCGA
rJMFF025B18+ CCAAGTTCATCAGTGGCGGGGCCGA
                      ____________________________________________________________
consensus AAATTGGGCGCCGACGTCGTGGTTTCACAGCGTCTCCAAGTTCATCAGTGGCGGGGCCGA
 
. : . : . : . : . : . :
rJMSF045D17+ CATCATCGCAGGAGCNGTGTGTGGACCAGCAAGCGTTGTGAANGCAATGATGGACCTGTG
rJMSF044D17+ CATCATCGCAGGAGCGGTGTGTGGACCAGCAAGCGTTGTGAACGCAATGATGGACCTGTG
rJMFF034K21+ CATCATCGCAGGAGCGGTGTGTGGACCAGCAAGCGTTGTGAACGCAATGATGGACCTGTG
JMFS107H06- TGTGGACCAGCAAGCGTTGTGAACGCAATGATGGACCTGTG
rJMFF019G01+ CATCATCGCAGGAGCGGTGTGTGGACCAGCAAGCGTTGTGAACGCAATGATGGACCTGTG
rJMFF025B18+ CATCATCGCAGGAGCGGTGTGTGGACCAGCAAGCGTTGTGAACGCAATGATGGACCTGTG
rJMFF039N14+ CAGGAGCGGTGTGTGGACCAGCAAGCGTTGTGAACGCAATGATGGACCTGTG
                      ____________________________________________________________
consensus CATCATCGCAGGAGCGGTGTGTGGACCAGCAAGCGTTGTGAACGCAATGATGGACCTGTG
 
. : . : . : . : . : . :
rJMSF045D17+ TGATGGGCCGCTAATGCTATTGGGTCCAACGATGAACGCGAAGGTGGCGTTTGAGCTTTC
rJMSF044D17+ TGATGGGCCGCTAATGCTATTGGGTCCAACGATGAACGCGAAGGTGGCGTTTGAGCTTTC
rJMFF034K21+ TGATGGGCCGCTAATGCTATTGGGTCCAACGATGAACGCGAAGGTGGCGTTTGAGCTTTC
JMFS107H06- TGATGGGCCGCTAATGCTATTGGGTCCAACGATGAACGCGAAGGTGGCGTTTGAGCTTTC
rJMFF019G01+ TGATGGGCCGCTAATGCTATTGGGTCCAACGATGAACGCGAAGGTGGCGTTTGAGCTTTC
rJMFF025B18+ TGATGGGCCGCTAATGCTATTGGGTCCAACGATGAACGCGAAGGTGGCGTTTGAGCTTTC
rJMFF039N14+ TGATGGGCCGCTAATGCTATTGGGTCCAACGATGAACGCGAAGGTGGCGTTTGAGCTTTC
                      ____________________________________________________________
consensus TGATGGGCCGCTAATGCTATTGGGTCCAACGATGAACGCGAAGGTGGCGTTTGAGCTTTC
 
. : . : . : . : . : . :
rJMSF045D17+ AGAACGGATTCCCCATTTGGGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
rJMSF044D17+ AGAACGGATTCCCCATTTGGGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
rJMFF034K21+ AGAACGGATTCCCCATTTGGGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
JMFS107H06- AGAACGGATTCCCCATTTGGGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
rJMFF019G01+ AGAACGGATTCCCCATTTGGGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
rJMFF025B18+ AGAACGGATTCCCCATTTGGGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
rJMFF039N14+ AGAACGGATTCCCCATTTGGGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
rJMSF041K17+ GGGCGATGCAGTT
rJMFF027C20+ CTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
rJMFF023C21+ CGATGCAGTT
rJMFF045C06+ CTGCAACCGGGCGATGCAGTT
rJMFF006I11+ GGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
rJMFF002A15+ GGCGATGCAGTT
rJMFF024N02+ CGGGCGATGCAGTT
                      ____________________________________________________________
consensus AGAACGGATTCCCCATTTGGGGCTGAGAATGAAGGAGCACTGCAACCGGGCGATGCAGTT
 
. : . : . : . : . : . :
rJMSF045D17+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMSF044D17+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF034K21+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
JMFS107H06- CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF019G01+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF025B18+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF039N14+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMSF041K17+ CGCGACGAGG-CTGAAGAAAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF027C20+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF023C21+ CGCGACGAGGCCTGAAG-AAGGTGGGGATAAGAGTGATNTACCCGGGGCTGGAAGAGCAC
rJMSF032E21+ TGAAG-AAGGT-GGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF030M09+ GGCTGGAAGAGCAC
rJMFF025N01+ GCTGGAAGAGCAC
rJMFF045C06+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF049J05+ AAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF006I11+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF002A15+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
rJMFF032C01+ CTGGANGAGCAC
rJMFF024N02+ CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
                      ____________________________________________________________
consensus CGCGACGAGG-CTGAAG-AAGGTGGGGATAAGAGTGATCTACCCGGGGCTGGAAGAGCAC
 
. : . : . : . : . : . :
rJMSF045D17+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGNTTCGGCGGCCTCATC
rJMSF044D17+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF034K21+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
JMFS107H06- CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF019G01+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF025B18+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF039N14+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMSF041K17+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF027C20+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF023C21+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGNTACGGCTTCGGCGGCCTCATC
rJMSF032E21+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF030M09+ CCGGATCACGCCNTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF025N01+ CCGGATCACGCCNTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF045C06+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF049J05+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF049A03+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF006I11+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF002A15+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF032C01+ CCGGATCACGCCNTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF024N02+ CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
rJMFF018E02+ CTCATC
                      ____________________________________________________________
consensus CCGGATCACGCCCTCTTCAAGTCCATGGCCAACAAGGGCTACGGCTTCGGCGGCCTCATC
 
. : . : . : . : . : . :
rJMSF045D17+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACNTGCTGCAAAACCAC
rJMSF044D17+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF034K21+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
JMFS107H06- GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF019G01+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF025B18+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF039N14+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMSF041K17+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF027C20+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF023C21+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMSF032E21+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF030M09+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF025N01+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF045C06+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF049J05+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF049A03+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF006I11+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF002A15+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF032C01+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF024N02+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
rJMFF018E02+ GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
                      ____________________________________________________________
consensus GGCGTCGACATGGAGACGGAGGACCGGGCCAACCGCTTCATGAACCTGCTGCAAAACCAC
 
. : . : . : . : . : . :
rJMSF045D17+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMSF044D17+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF034K21+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
JMFS107H06- ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF019G01+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF025B18+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF039N14+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMSF041K17+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF027C20+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF023C21+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMSF032E21+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF030M09+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF025N01+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF045C06+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF049J05+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF049A03+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF006I11+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF002A15+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF032C01+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF024N02+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF018E02+ ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
rJMFF046G07+ GTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
                      ____________________________________________________________
consensus ACACAGTTCGGGTTCATCGCCGTCAGCTTGGGCTACTACGAGACCCTCATGTCCTGCTCC
 
. : . : . : . : . : . :
rJMSF045D17+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMSF044D17+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF034K21+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
JMFS107H06- GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF019G01+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF025B18+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF039N14+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMSF041K17+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF027C20+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF023C21+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMSF032E21+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF030M09+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF025N01+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAACCTCTCCC
rJMFF045C06+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF049J05+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF049A03+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF006I11+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF002A15+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF032C01+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF024N02+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF018E02+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
rJMFF046G07+ GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
                      ____________________________________________________________
consensus GGCAGCAGCACCAGCAGCGAGATGAACACCGAGGCCAAGGAGCTCGCCGGAATCTCTCCC
 
. : . : . : . : . : . :
rJMSF045D17+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMSF044D17+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF034K21+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
JMFS107H06- GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF019G01+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF025B18+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF039N14+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMSF041K17+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF027C20+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF023C21+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMSF032E21+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF030M09+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF025N01+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF045C06+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF049J05+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF049A03+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF006I11+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF027J05+ TGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGGAATGGGGCCAGCTG
rJMFF002A15+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGGAATGGGGCCAGCTG
rJMFF032C01+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF024N02+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGGAATGGGGCCAGCTG
rJMFF018E02+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
rJMFF046G07+ GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
                      ____________________________________________________________
consensus GGACTGATCAGAATGTCGGTTGGGTATACCGGGACCTTGGAGCAGAAATGGGGCCAGCTG
 
. : . : . : . : . : . :
rJMSF045D17+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTNTGCTGGCTTGTTCCAGAAGAGTTGA
rJMSF044D17+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF034K21+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
JMFS107H06- GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF019G01+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF025B18+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF039N14+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMSF041K17+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF027C20+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF023C21+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMSF032E21+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF030M09+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF025N01+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF045C06+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF049J05+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF049A03+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF006I11+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF027J05+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTNTTCTGCTGGCTTGTTCCAGAAGAGTTGA
JMFS041H02+ TTCTTCTGCTGGCTTGTTCCAGGACAGTTGA
rJMFF002A15+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF032C01+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF024N02+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF018E02+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
rJMFF046G07+ GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTTTGCTGGCTTGTTCCAGAAGAGTTGA
                      ____________________________________________________________
consensus GAGAAGGCACTCTCAAGAATGCAGCAGGATTCTTCTGCTGGCTTGTTCCAGAAGAGTTGA
 
. : . : . : . : . : . :
rJMSF045D17+ ATGTTATTAG-TTTCTATCCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTA
rJMSF044D17+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF034K21+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
JMFS107H06- ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTA
rJMFF019G01+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF025B18+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF039N14+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMSF041K17+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF027C20+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF023C21+ ATGTTATTAGTTTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMSF032E21+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF030M09+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTGATCCTTAAGAACTTTTATGGT
rJMFF025N01+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF045C06+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF049J05+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF049A03+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF006I11+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF027J05+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCNTTAATCCTTAAGAACTTTTATGGT
JMFS041H02+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF002A15+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF032C01+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF024N02+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF018E02+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
rJMFF046G07+ ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
                      ____________________________________________________________
consensus ATGTTATTAG-TTTCTA-CCTATTGCATGTGTTTCCTTAATCCTTAAGAACTTTTATGGT
 
. : . : . : . : . : . :
rJMSF044D17+ ACGTACTGGTTGGTT
rJMFF034K21+ ACGTACTGGTTGGTTTGGTTTGATATATGGATG
rJMFF019G01+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAAC
rJMFF025B18+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF039N14+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMSF041K17+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF027C20+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF023C21+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMSF032E21+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF030M09+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF025N01+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF045C06+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF049J05+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF049A03+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF006I11+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF027J05+ ACGTACTGGTTGGNNTGGTNTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
JMFS041H02+ ACGTTCTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAGCAATTAA
rJMFF002A15+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF032C01+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF024N02+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF018E02+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
rJMFF046G07+ ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
                      ____________________________________________________________
consensus ACGTACTGGTTGGTTTGGTTTGATATATGGATGGTCCAATGAGGGAGAACGAACAATTAA
 
. : . : . : . : . : . :
rJMFF025B18+ ATCCATTATCATATCCCTTTAGGAATGTGTATGCAAC
rJMFF039N14+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCA
rJMSF041K17+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF027C20+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF023C21+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMSF032E21+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF030M09+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF025N01+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF045C06+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAA
rJMFF049J05+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAA
rJMFF049A03+ A
rJMFF006I11+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF027J05+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
JMFS041H02+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF002A15+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF032C01+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF024N02+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF018E02+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
rJMFF046G07+ AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
                      ____________________________________________________________
consensus AT-CATTATCATATCCCTTTAGGAATGTGTATGCAACGCAAGCCAAGTCAATAAACTCTG
 
. : . : . : . : . : . :
rJMSF041K17+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF027C20+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF023C21+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMSF032E21+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF030M09+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF025N01+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF006I11+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF027J05+ CTCTGNTGCTTAGTTTTAATTTGAGTNGTATGTANGTANGACATCATGCATGCAGCTGTG
JMFS041H02+ CTCTGCTGCTTAGTTTT
rJMFF002A15+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF032C01+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF024N02+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF018E02+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
rJMFF046G07+ CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
                      ____________________________________________________________
consensus CTCTGCTGCTTAGTTTTAATTTGAGTTGTATGTATGTATGACATCATGCATGCAGCTGTG
 
. : . : . : . : . : . :
rJMSF041K17+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMFF027C20+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTG
rJMFF023C21+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMSF032E21+ TGTTGATAAGATAGAGTTAAGCAGGCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACC
rJMFF030M09+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMFF025N01+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMFF006I11+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMFF027J05+ TGTTGATAAGATAGAGTTAAGCA-NCTAAGTGTTGTTGTTGTCTCGCCGGATCATCACCA
rJMFF002A15+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMFF032C01+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMFF024N02+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMFF018E02+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
rJMFF046G07+ TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
                      ____________________________________________________________
consensus TGTTGATAAGATAGAGTTAAGCA-GCTAAGTGTTGTTGTTGTCTTGTTGGATCATCACCA
 
. : . : . : . : . : . :
rJMSF041K17+ TAGT
rJMFF023C21+ TAGT
rJMFF030M09+ TA
rJMFF025N01+ TAG
rJMFF006I11+ TAGT
rJMFF027J05+ T
rJMFF002A15+ TA
rJMFF032C01+ TAGTTTTTATGGACAA
rJMFF024N02+ TAGTTTTTATGGACAA
rJMFF018E02+ TAGTTTTTATGGACAA
rJMFF046G07+ TAGTTTTTATGGACAATGCATGTGTTGATTGTTGAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TAGTTTTTATGGACAATGCATGTGTTGATTGTTGAAAAAAAAAAAAAAACTCTCCAGGGT