Previous Contig 010636:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009P13Sequence126010636 (9)gb:AF432345_17994995e-08Tortula ruralis 26S proteasome regulatory subunit IV (RPT2) mRNA, complete cds.
JMFF010P08Sequence436007965 (15)gb:AF372977_17926891e-52Arabidopsis thaliana At2g20140/T2G17.6 mRNA, complete cds.740010636 (9)gb:AP004333_18403623e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P003
JMFF021E15Sequence483007965 (15)gb:AF372977_17926892e-62Arabidopsis thaliana At2g20140/T2G17.6 mRNA, complete cds.735010636 (9)gb:AP004333_18403623e-88Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P003
JMFF026O22Sequence565007965 (15)pir|E84585|E845855e-8026S proteasome subunit 4 [imported] - Arabidopsis thaliana>gb:AC006081_1533427 A740010636 (9)gb:AP004333_18403623e-87Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P003
JMFF026P09Sequence722010636 (9)gb:AP004333_18403622e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P003
JMFF027C14Sequence502007965 (15)gb:AF372977_17926894e-69Arabidopsis thaliana At2g20140/T2G17.6 mRNA, complete cds.745010636 (9)gb:AP004333_18403622e-90Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P003
JMFF046F11Sequence581007965 (15)gb:AF372977_17926892e-72Arabidopsis thaliana At2g20140/T2G17.6 mRNA, complete cds.323010636 (9)gb:AP004333_18403628e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P003
JMSF045M10Sequence782007965 (15)pir|E84585|E84585e-12426S proteasome subunit 4 [imported] - Arabidopsis thaliana>gb:AC006081_1533427 A738010636 (9)gb:AP004333_18403628e-92Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P003
JMSF050A17Sequence693007965 (15)pir|E84585|E84585e-10126S proteasome subunit 4 [imported] - Arabidopsis thaliana>gb:AC006081_1533427 A731010636 (9)gb:AP004333_18403621e-88Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P003

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045M10+ TCTTGCGTGNTGTTGGAAGTGAACTGATACAG-AAGTACTTGGG
rJMFF026P09+ GGAAGTGAACTGATACAG-AAGTACTTGGG
rJMSF050A17+ ACTGATACAG-AAGTACTTGGG
rJMFF027C14+ GGAAGTGAACTGATACAG-AAGTACTTGGG
rJMFF026O22+ TGAACTGATACAGAAAGTACTTGGG
rJMFF021E15+ TGATACAG-AAGTACTTGGG
rJMFF010P08+ GAACTGATACAG-AAGTACTTGGG
                      ____________________________________________________________
consensus TCTTGCGTGNTGTTGGAAGTGAACTGATACAG-AAGTACTTGGG
 
. : . : . : . : . : . :
rJMSF045M10+ AGATGGTCCCAAATTGGTGAGAGAGCTATTTAGGGTTGCTGATGAACTCTCACCTGCTAT
rJMFF026P09+ AGATGGTCCCAAATTGGTGAGAGAGCTATTTAGGGTTGCTGATGAACTCTCACNTGCTAT
rJMSF050A17+ AGATGGTCCCAAATTGGTGAGAGAGCTATTTAGGGTTGCTGATGAACTCTCACCTGCTAT
rJMFF027C14+ AGATGGTCCCAAATTGGTGAGAGAGCTATTTAGGGTTGCTGATGAACTCTCACCTGCTAT
rJMFF026O22+ AGATGGTCCCAAATTGGTGAGAGAGCTATTTAGGGTTGCTGATGAACTCTCACCTGCTAT
rJMFF021E15+ AGATGGTCCCAAATTGGTGAGAGAGCTATTTAGGGTTGCTGATGAACTCTCACCTGCTAT
rJMFF010P08+ AGATGGTCCCAAATTGGTGAGAGAGCTATTTAGGGTTGCTGATGAACTCTCACCTGCTAT
                      ____________________________________________________________
consensus AGATGGTCCCAAATTGGTGAGAGAGCTATTTAGGGTTGCTGATGAACTCTCACCTGCTAT
 
. : . : . : . : . : . :
rJMSF045M10+ TGTCTTTATTGATGAAATTGATGCGGTTGGTACCAAAAGGTATGATGCACACTCGGGTGG
rJMFF026P09+ TGTCTTTATTGATGAAATTGATGCGGTTGGTACCAAAAGGTATGATGCACACTCGGGTGG
rJMSF050A17+ TGTCTTTATTGATGAAATTGATGCGGTTGGTACCAAAAGGTATGATGCACACTCGGGTGG
rJMFF027C14+ TGTCTTTATTGATGAAATTGATGCGGTTGGTACCAAAAGGTATGATGCACACTCGGGTGG
rJMFF026O22+ TGTCTTTATTGATGAAATTGATGCGGTTGGTACCAAAAGGTATGATGCACACTCGGGTGG
rJMFF021E15+ TGTCTTTATTGATGAAATTGATGCGGTTGGTACCAAAAGGTATGATGCACACTCGGGTGG
rJMFF010P08+ TGTCTTTATTGATGAAATTGATGCGGTTGGTACCAAAAGGTATGATGCACACTCGGGTGG
                      ____________________________________________________________
consensus TGTCTTTATTGATGAAATTGATGCGGTTGGTACCAAAAGGTATGATGCACACTCGGGTGG
 
. : . : . : . : . : . :
rJMSF045M10+ TGAGCGTGAAATTCAGCGTACCATGCTTGAACTGCTTAACCAGCTAGATGGTTTTGACTC
rJMFF026P09+ TGAGCGTGAAATTCAGCGTACCATGCTTGAACTGCTTAACCAGCTAGATGGTTTTGACTC
rJMSF050A17+ TGAGCGTGAAATTCAGCGTACCATGCTTGAACTGCTTAACCAGCTAGATGGTTTTGACTC
rJMFF027C14+ TGAGCGTGAAATTCAGCGTACCATGCTTGAACTGCTTAACCAGCTAGATGGTTTTGACTC
rJMFF026O22+ TGAGCGTGAAATTCAGCGTACCATGCTTGAACTGCTTAACCAGCTAGATGGTTTTGACTC
rJMFF021E15+ TGAGCGTGAAATTCAGCGTACCATGCTTGAACTGCTTAACCAGCTAGATGGTTTTGACTC
rJMFF010P08+ TGAGCGTGAAATTCAGCGTACCATGCTTGAACTGCTTAACCAGCTAGATGGTTTTGACTC
                      ____________________________________________________________
consensus TGAGCGTGAAATTCAGCGTACCATGCTTGAACTGCTTAACCAGCTAGATGGTTTTGACTC
 
. : . : . : . : . : . :
rJMSF045M10+ ACGGGGAGATGTGAAGGTAATCCTAGCCACTAATAAGATTGAGAGCCTTGATCCTGCCCT
rJMFF026P09+ ACGGGGAGATGTGAAGGTAATCCTAGCCACTAATAAGATTGAGAGCCTTGATCCTGCCCT
rJMSF050A17+ ACGGGGAGATGTGAAGGTAATCCTAGCCACTAATAAGATTGAGAGCCTTGATCCTGCCCT
rJMFF027C14+ ACGGGGAGATGTGAAGGTAATCCTAGCCACTAATAAGATTGAGAGCCTTGATCCTGCCCT
rJMFF026O22+ ACGGGGAGATGTGAAGGTAATCCTAGCCACTAATAAGATTGAGAGCCTTGATCCTGCCCT
rJMFF021E15+ ACGGGGAGATGTGAAGGTAATCCTAGCCACTAATAAGATTGAGAGCCTTGATCCTGCCCT
rJMFF010P08+ ACGGGGAGATGTGAAGGTAATCCTAGCCACTAATAAGATTGAGAGCCTTGATCCTGCCCT
                      ____________________________________________________________
consensus ACGGGGAGATGTGAAGGTAATCCTAGCCACTAATAAGATTGAGAGCCTTGATCCTGCCCT
 
. : . : . : . : . : . :
rJMSF045M10+ GCTTCGACCTGGCAGAATTGACAGGAAAATTGAATTTCCTCTTCCTGATATCAAAACAAG
rJMFF026P09+ GCTTCGACCTGGCAGAATTGACAGGAAAATTGAATTTCCTCTTCCTGATATCAAAACAAG
rJMSF050A17+ GCTTCGACCTGGCAGAATTGACAGGAAAATTGAATTTCCTCTTCCTGATATCAAAACAAG
rJMFF027C14+ GCTTCGACCTGGCAGAATTGACAGGAAAATTGAATTTCCTCTTCCTGATATCAAAACAAG
rJMFF026O22+ GCTTCGACCTGGCAGAATTGACAGGAAAATTGAATTTCCTCTTCCTGATATCAAAACAAG
rJMFF021E15+ GCTTCGACCTGGCAGAATTGACAGGAAAATTGAATTTCCTCTTCCTGATATCAAAACAAG
rJMFF010P08+ GCTTCGACCTGGCAGAATTGACAGGAAAATTGAATTTCCTCTTCCTGATATCAAAACAAG
                      ____________________________________________________________
consensus GCTTCGACCTGGCAGAATTGACAGGAAAATTGAATTTCCTCTTCCTGATATCAAAACAAG
 
. : . : . : . : . : . :
rJMSF045M10+ GCGGAGGATTTTCCAGATACACACAGCAAGGATGACCCTGGCTGATGATGTCAACTTAGA
rJMFF026P09+ GCGGAGGATTTTCCAGATACACACAGCAAGGATGACCCTGGCTGATGATGTCAACTTAGA
rJMSF050A17+ GCGGAGGATTTTCCAGATACACACAGCAAGGATGACCCTGGCTGATGATGTCAACTTAGA
rJMFF027C14+ GCGGAGGATTTTCCAGATACACACAGCAAGGATGACCCTGGCTGATGATGTCAACTTAGA
rJMFF026O22+ GCGGAGGATTTTCCAGATACACACAGCAAGGATGACCCTGGCTGATGATGTCAACTTAGA
rJMFF021E15+ GCGGAGGATTTTCCAGATACACACAGCAAGGATGACCCTGGCTGATGATGTCAACTTAGA
rJMFF009P13+ TAGA
rJMFF010P08+ GCGGAGGATTTTCCAGATACACACAGCAAGGATGACCCTGGCTGATGATGTCAACTTAGA
                      ____________________________________________________________
consensus GCGGAGGATTTTCCAGATACACACAGCAAGGATGACCCTGGCTGATGATGTCAACTTAGA
 
. : . : . : . : . : . :
rJMSF045M10+ AGAGTTTGTCATGACAAAAGACGAGTTTTCTGGAGCCGATATCAAGGCCATTTGTACTGA
rJMFF026P09+ AGAGTTTGTCATGACAAAAGACGAGTTTTCTGGAGCCGATATCAAGGCCATTTGTACTGA
rJMSF050A17+ AGAGTTTGTCATGACAAAAGACGAGTTTTCTGGAGCCGATATCAAGGCCATTTGTACTGA
rJMFF027C14+ AGAGTTTGTCATGACAAAAGACGAGTTTTCTGGAGCCGATATCAAGGCCATTTGTACTGA
rJMFF026O22+ AGAGTTTGTCATGACAAAAGACGAGTTTTCTGGAGCCGATATCAAGGCCATTTGTACTGA
rJMFF021E15+ AGAGTTTGTCATGACAAAAGACGAGTTTTCTGGAGCCGATATCAAGGCCATTTGTACTGA
rJMFF009P13+ AGAGTTTGTCATGACAAAANACGAGTTTTCNGGAGCCGATATCAAGGCCATTTGTNCTGA
rJMFF010P08+ AGAGTTTGTCATGACAAAAGACGAGTTTTCTGGAGCCGATATCAAGGCCATTTGTACTGA
rJMFF046F11+ CGATATCAAGGCCATTTGTACTGA
                      ____________________________________________________________
consensus AGAGTTTGTCATGACAAAAGACGAGTTTTCTGGAGCCGATATCAAGGCCATTTGTACTGA
 
. : . : . : . : . : . :
rJMSF045M10+ AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCAAGAA
rJMFF026P09+ AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCAAGAA
rJMSF050A17+ AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCAAGAA
rJMFF027C14+ AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCAAGAA
rJMFF026O22+ AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCAAGAA
rJMFF021E15+ AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCAAGAA
rJMFF009P13+ AGNNGGATTGCTNNCNTTAAGAGAGAGG
rJMFF010P08+ AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCAAGAA
rJMFF046F11+ AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCGAGAA
                      ____________________________________________________________
consensus AGCTGGATTGCTCGCGTTAAGAGAGAGGCGTATGAAGGTAACTCATGCTGATTTCAAGAA
 
. : . : . : . : . : . :
rJMSF045M10+ AGCCAAGGACAAGGTGATGTTCAAGAAGAAAGAGGGAGTCCCTGAAGGGCTTTACATGTA
rJMFF026P09+ AGCCAAGGACAAGGTGATGTTCAAGAAGAAAGAGGGAGTCCCTGAAGGGCTTTACATGTA
rJMSF050A17+ AGCCAAGGACAAGGTGATGTTCAAGAAGAAAGAGGGAGTCCCTGAAGGGCTTTACATGTA
rJMFF027C14+ AGCCAAGGACAAGGTGATGTTCAAGAAGAAAGAGGGAGTCCCTGAAGGGCTTTACATGTA
rJMFF026O22+ AGCCAAGGACAAGGTGATGTTCAAGAAGAAAGAGGGAGTCCCTGAAGGGCTTTACATGTA
rJMFF021E15+ AGCCAAGGACAAGGTGATGTTCAAGAAGAAGGAGGGAGTCCCTGAAGGGCTTTACATGTA
rJMFF010P08+ AGCCAAGGACAAGGTGATGTTCAAGAAGAAGGAGGGAGTCCCTGAAGGGCTTTACATGTA
rJMFF046F11+ AGCCAAGGACAAGGTGATGTTCAAGAAGAAAGAGGGAGTCCCTGAAGGGCTTTACATGTA
                      ____________________________________________________________
consensus AGCCAAGGACAAGGTGATGTTCAAGAAGAAAGAGGGAGTCCCTGAAGGGCTTTACATGTA
 
. : . : . : . : . : . :
rJMSF045M10+ GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTCTTCCCTTTATA
rJMFF026P09+ GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTCTTCCCTTTATA
rJMSF050A17+ GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTCTTCCCTTTATA
rJMFF027C14+ GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTCTTCCCTTTATA
rJMFF026O22+ GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTCTTCCCTTTATA
rJMFF021E15+ GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTCTTCCCTTTATA
rJMFF010P08+ GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTCTTCCCTTTATA
rJMFF046F11+ GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTTTTCCCTTTATA
                      ____________________________________________________________
consensus GTGAAGAATTACTTTTCTCAATTTGTACGGTGGCATTCAATGCTCCTTCTTCCCTTTATA
 
. : . : . : . : . : . :
rJMSF045M10+ TCAGCTTTCTGTAAACATTAAAAGCTCTGCTTCACAACATTGATGAAATCTGTAGCCATC
rJMFF026P09+ TCAGCTTTCTGTAAACATTAAAAGCTCTGCTTCACAACATTGATGAAATCTGTAGCCATC
rJMSF050A17+ TCAGCTTTCTGTAAACATTAAAAGCTCTGCTTCACAACATTGATGAAATCTGTAGCCATC
rJMFF027C14+ TCAGCTTTCTGTAAACATTAAAAGCTCTGCTTCACAACATTGATGAAATCTGTAGCCATC
rJMFF026O22+ TCAGCTTTCTGTAAACATTAAAAGCTCTGCTTCACAACATTGATGAAATCTGTAGCCATC
rJMFF021E15+ TCAGCTTTCTGTAAACATTAAAAGCTCTGCTTCACAACATTGATGAAATCTGTAGCCATC
rJMFF010P08+ TCAGCTTTCTGTAAACATTAAAAGCTCTGCTTCACAACATTGATGAAATCTGTAGCCATC
rJMFF046F11+ TCAGCTTTCTGTAAACATTAAAAGCTTTGCTTCACAACATTGATGAAATCTGTAGCCATC
                      ____________________________________________________________
consensus TCAGCTTTCTGTAAACATTAAAAGCTCTGCTTCACAACATTGATGAAATCTGTAGCCATC
 
. : . : . : . : . : . :
rJMSF045M10+ TGTACTATGTGAGAACA-CATGGCCCCGTCTCACAT
rJMFF026P09+ TGTACTATGTGAGAACA-CATGGCCCCGTCTCAC
rJMSF050A17+ TGTACTATGTGAGAACACCATGGCCCCGTCTCACATCACTGCTTT
rJMFF027C14+ TGTACTATGTGAGAACA-CATGGCCCCGTCTCACATCACTGCTTTTGGCTCAATTT
rJMFF026O22+ TGTACTATGTGAGAACA-CATGGCCCCGTCTCACATCACTGCTTTTGGCTCAATTT
rJMFF021E15+ TGTACTATGTGAGAACA-CATGGCCCCGTCTCACATCACTGCTTTTGGCTCAATTT
rJMFF010P08+ TGTACTATGTGAGAACA-CATGGCCCCGTCTCACATCACTGCTTTTGGCTCAATTT
rJMFF046F11+ TGTACTATGTGAGAACA-CATGGCCCCGTCTCACATCACTGCTTTTGGCTCAATTTTATG
                      ____________________________________________________________
consensus TGTACTATGTGAGAACA-CATGGCCCCGTCTCACATCACTGCTTTTGGCTCAATTTTATG