Previous Contig 010633:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010K10Sequence549000552 (7)gb:AB154370_15283652e-67Ipomoea tricolor ItIVS mRNA for bHLH transcription activator Ivory seed, complet729010633 (7)gb:AB154369_1528364e-109Ipomoea purpurea IpIVS mRNA for bHLH transcription activator Ivory seed, complet
JMFF014I24Sequence544000552 (7)gb:AB154370_15283652e-66Ipomoea tricolor ItIVS mRNA for bHLH transcription activator Ivory seed, complet758010633 (7)gb:AB154369_15283644e-99Ipomoea purpurea IpIVS mRNA for bHLH transcription activator Ivory seed, complet
JMFF022P13Sequence495000552 (7)gb:AB154370_15283651e-67Ipomoea tricolor ItIVS mRNA for bHLH transcription activator Ivory seed, complet666010633 (7)gb:AB154369_15283644e-54Ipomoea purpurea IpIVS mRNA for bHLH transcription activator Ivory seed, complet
JMFF030J13Sequence405000552 (7)gb:AB154370_15283651e-40Ipomoea tricolor ItIVS mRNA for bHLH transcription activator Ivory seed, complet671010633 (7)gb:AB154369_15283641e-94Ipomoea purpurea IpIVS mRNA for bHLH transcription activator Ivory seed, complet
JMFF038G22Sequence543000552 (7)gb:AB154370_15283652e-66Ipomoea tricolor ItIVS mRNA for bHLH transcription activator Ivory seed, complet233010633 (7)gb:AB154370_15283652e-06Ipomoea tricolor ItIVS mRNA for bHLH transcription activator Ivory seed, complet
JMFF046F02Sequence545000552 (7)gb:AB154370_15283652e-62Ipomoea tricolor ItIVS mRNA for bHLH transcription activator Ivory seed, complet455010633 (7)gb:AB154369_15283644e-46Ipomoea purpurea IpIVS mRNA for bHLH transcription activator Ivory seed, complet
JMFF048F20Sequence361000552 (7)gb:AB154370_15283651e-33Ipomoea tricolor ItIVS mRNA for bHLH transcription activator Ivory seed, complet303010633 (7)gb:AB154369_15283645e-25Ipomoea purpurea IpIVS mRNA for bHLH transcription activator Ivory seed, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010K10+ TAAGCTCTGCAAGG
rJMFF014I24+ CTCTGCAAGG
                      ____________________________________________________________
consensus TAAGCTCTGCAAGG
 
. : . : . : . : . : . :
rJMFF010K10+ CCGCACCCCAAGAAGAGCCCAACGTCAATCACGTCCTGGCGGAGCGCCGCCGCCGGGAG-
rJMFF030J13+ GGAGCGCCGCCGCCGGGAGA
rJMFF014I24+ CCGCACCCCAAGAAGAGCCCAACGTCAATCACGTCCTGGCGGAGCGCCGCCGCCGGGAGA
                      ____________________________________________________________
consensus CCGCACCCCAAGAAGAGCCCAACGTCAATCACGTCCTGGCGGAGCGCCGCCGCCGGGAGA
 
. : . : . : . : . : . :
rJMFF010K10+ AAGCTCAACGAGCGGTTCATTATCCTCAGGTCGCTCGTGCCTTTCGTGACGAAAATGGAC
rJMFF030J13+ AAGCTCAACGAGCGGTTCATTATCCTCAGGTCGCTCGTGCCTTTCGTGACGAAAATGGAC
rJMFF014I24+ AAGCTCAACGAGCGGTTCATTATCCTCAGGTCGCTCGTGCCTTTCGTGACGAAAATGGAC
                      ____________________________________________________________
consensus AAGCTCAACGAGCGGTTCATTATCCTCAGGTCGCTCGTGCCTTTCGTGACGAAAATGGAC
 
. : . : . : . : . : . :
rJMFF010K10+ AAGGCCTCCATTCTCGGCGACACCATTGAGTACGTCAAGCAGTTGCGCCGGAGAATCCAG
rJMFF030J13+ AAGGCCTCCATTCTCGGCGACACCATTGAGTACGTCAAGCAGTTGCGCCGGAGAATCCAG
rJMFF014I24+ AAGGCCTCCATTCTCGGCGACACCATTGAGTACGTCAAGCAGTTGCGCCGGAGAATCCAG
                      ____________________________________________________________
consensus AAGGCCTCCATTCTCGGCGACACCATTGAGTACGTCAAGCAGTTGCGCCGGAGAATCCAG
 
. : . : . : . : . : . :
rJMFF010K10+ GAGCTGGAGGCGCCGACGGAGGTTGACCGGCAGTCGATTACCGGCGGGGTTACACGAAAG
rJMFF030J13+ GAGCTGGAGGCGCCGACGGAGGTTGACCGGCAGTCGATTACCGGCGGGGTTACACGAAAG
rJMFF014I24+ GAGCTGGAGGCGCCGACGGAGGTTGACCGGCAGTCGATTACCGGCGGGGTTACACGAAAG
                      ____________________________________________________________
consensus GAGCTGGAGGCGCCGACGGAGGTTGACCGGCAGTCGATTACCGGCGGGGTTACACGAAAG
 
. : . : . : . : . : . :
rJMFF010K10+ AATCCACCCCAGAAAAGTGGGGCCTCCAGAACTCAGATGGGTCCCAGGCTGAATAAGAGG
rJMFF030J13+ AATCCACCCCAGAAAAGTGGGGCCTCCAGAACTCAGATGGGTCCCAGGCTGAATAAGAGG
rJMFF014I24+ AATCCACCCCAGAAAAGTGGGGCCTCCAGAACTCAGATGGGTCCCAGGCTGAATAAGAGG
rJMFF022P13+ GTCCCAGGCTGAATAAGAGG
                      ____________________________________________________________
consensus AATCCACCCCAGAAAAGTGGGGCCTCCAGAACTCAGATGGGTCCCAGGCTGAATAAGAGG
 
. : . : . : . : . : . :
rJMFF010K10+ GGGACGAGGACGGCAGAGAGAGGCGGCCGGCCGGAGAATAACACGGAGGAGGACGCGGTG
rJMFF030J13+ GGGACGAGGACGGCAGAGAGAGGCGGCCGGCCGGAGAATAACACGGAGGAGGACGCGGTG
rJMFF014I24+ GGGACGAGGACGGCAGAGAGAGGCGGCCGGCCGGAGAATAACACGGAGGAGGACGCGGTG
rJMFF022P13+ GGGACGAGGACGGCAGAGAGAGGCGGCCGGCCGGAGAATAACACGGAGGAGGACGCGGTG
rJMFF046F02+ GCCGGCCGGAGAATAACACGGAGGAGGACGCGGTG
                      ____________________________________________________________
consensus GGGACGAGGACGGCAGAGAGAGGCGGCCGGCCGGAGAATAACACGGAGGAGGACGCGGTG
 
. : . : . : . : . : . :
rJMFF010K10+ GTTCAAGTGGAAGTTTCTATCATCGAGAGCGATGCACTGGTGGAGCTGCGATGCACTTAC
rJMFF030J13+ GTTCAAGTGGAAGTTTCTATCATCGAGAGCGATGCACTGGTGGAGCTGCGATGCACTTAC
rJMFF014I24+ GTTCAAGTGGAAGTTTCTATCATCGAGAGCGATGCACTGGTGGAGCTGCGATGCACTTAC
rJMFF022P13+ GTTCAAGTGGAAGTTTCTATCATCGAGAGCGATGCACTGGTGGAGCTGCGATGCACTTAC
rJMFF046F02+ GTTCAAGTGGAAGTTTCTATCATCGAGAGCGATGCACTGGTGGAGCTGCGATGCACTTAC
                      ____________________________________________________________
consensus GTTCAAGTGGAAGTTTCTATCATCGAGAGCGATGCACTGGTGGAGCTGCGATGCACTTAC
 
. : . : . : . : . : . :
rJMFF010K10+ AGGCAGGGCTTAATCTTGGATGTCATGCAGATGCTTAAAGAGCTTGGACTTGAAATCACC
rJMFF030J13+ AGGCAGGGCTTAATCTTGGATGTCATGCAGATGCTTAAAGAGCTTGGACTTGAAATCACC
rJMFF048F20+ GGATGTCATGCAGATGCTTAAAGAGCTTGGACTTGAAATCACC
rJMFF014I24+ AGGCAGGGCTTAATCTTGGATGTCATGCAGATGCTTAAAGAGCTTGGACTTGAAATCACC
rJMFF022P13+ AGGCAGGGCTTAATCTTGGATGTCATGCAGATGCTTAAAGAGCTTGGACTTGAAATCACC
rJMFF046F02+ AGGCAGGGCTTAATCTTGGATGTCATGCAGATGCTTAAAGAGCTTGGACTTGAAATCACC
                      ____________________________________________________________
consensus AGGCAGGGCTTAATCTTGGATGTCATGCAGATGCTTAAAGAGCTTGGACTTGAAATCACC
 
. : . : . : . : . : . :
rJMFF038G22+ TAAAA
rJMFF010K10+ ACCGTCCAATCTTCTGTTAACGGTGGGATCTTTTGTGCTGAATTGAGAGCTAAGCTAAAA
rJMFF030J13+ ACCGTCCAATCTTCTGTTAACGGTGGGATCTTTTGTGCTGAATTGAGAGCTAAGCTAAAA
rJMFF048F20+ ACCGTCCAATCTTCTGTTAACGGTGGGATCTTTTGTGCTGAATTGAGAGCTAAGCTAAAA
rJMFF014I24+ ACCGTCCAATCTTCTGTTAACGGTGGGATCTTTTGTGCTGAATTGAGAGCTAAGCTAAAA
rJMFF022P13+ ACCGTCCAATCTTCTGTTAACGGTGGGATCTTTTGTGCTGAATTGAGAGCTAAGCTAAAA
rJMFF046F02+ ACCGTCCAATCTTCTGTTAACGGTGGGATCTTTTGTGCTGAATTGAGAGCTAAGCTAAAA
                      ____________________________________________________________
consensus ACCGTCCAATCTTCTGTTAACGGTGGGATCTTTTGTGCTGAATTGAGAGCTAAGCTAAAA
 
. : . : . : . : . : . :
rJMFF038G22+ GAAAATATGAAAGGCAGGAAAGCAACAATCATGGAAGTGAAAAAGGCAATTCATAGTATA
rJMFF010K10+ GAAAATATGAAAGGCAGGAAAGCAACAATCATGGAAGTGAAAAAGGCAATTCATAGTATA
rJMFF030J13+ GAAAATATGAAAGGCAGGAAAGCAACAATCATGGAAGTGAAAAAGGCAATTCATAGTATA
rJMFF048F20+ GAAAATATGAAAGGCAGGAAAGCAACAATCATGGAAGTGAAAAAGGCAATTCATAGTATA
rJMFF014I24+ GAAAATATGAAAGGCAGGAAAGCAACAATCATGGAAGTGAAAAAGGCAATTCATAGTATA
rJMFF022P13+ GAAAATATGAAAGGCAGGAAAGCAACAATCATGGAAGTGAAAAAGGCAATTCATAGTATA
rJMFF046F02+ GAAAATATGAAAGGCAGGAAAGCAACAATCATGGAAGTGAAAAAGGCAATTCATAGTATA
                      ____________________________________________________________
consensus GAAAATATGAAAGGCAGGAAAGCAACAATCATGGAAGTGAAAAAGGCAATTCATAGTATA
 
. : . : . : . : . : . :
rJMFF038G22+ ATTCCTCAGTTT
rJMFF010K10+ ATTCCTCAGTTTTAGCTATGGAGAAATATTCATACATGCATCTGCTGCAAGGTAGCCACT
rJMFF030J13+ ATTCCTCAGTTTTAGCTATGGAGAAATATTCATACATGCATCTGCTGCAAGGTAGCCACT
rJMFF048F20+ ATTCCTCAGTTTTAGCTATGGAGAAATATTCATACATGCATCTGCTGCAAGGTAGCCACT
rJMFF014I24+ ATTCCTCAGTTTTAGCTATGGAGAAATATTCATACATGCATCTGCTGCAAGGTAGCCACT
rJMFF022P13+ ATTCCTCAGTTTTAGCTATGGAGAAATATTCATACATGCATCTGCTGCAAGGTAGCCACT
rJMFF046F02+ ATTCCTCAGTTTTAGCTATGGAGAAATATTCATACATGCATCTGCTGCAAGGTAGCCACT
                      ____________________________________________________________
consensus ATTCCTCAGTTTTAGCTATGGAGAAATATTCATACATGCATCTGCTGCAAGGTAGCCACT
 
. : . : . : . : . : . :
rJMFF010K10+ AGTAGTCTAGTCGTGTAAACTCTTGTTGTCACTGTAAATTTATAATACTGCTGTTA
rJMFF030J13+ AGTAGTCTAGTCGTGTAAACTCTTGTTGTCACTGTAAATTTATAATACTGC
rJMFF048F20+ AGTAGTCTAGTCGTGTAAACTCTTGTTGTCACTGTAAATTTATAATACTGCTGTTATTGT
rJMFF014I24+ AGTAGTCTAGTCGTGTAAACTCTTGTTGTCACTGTAAATTTATAATACTGCTGTTATTGT
rJMFF022P13+ AGTAGTCTAGTCGTGTAAACTCTTGTTGTCACTGTAAATTTATAATACTGCTGTTATTGT
rJMFF046F02+ AGTAGTCTAGTCGTGTAAACTCTTGTTGTCACTGTAAATTTATAATACTGCTGTTATTGT
                      ____________________________________________________________
consensus AGTAGTCTAGTCGTGTAAACTCTTGTTGTCACTGTAAATTTATAATACTGCTGTTATTGT
 
. : . : . : . : . : . :
rJMFF048F20+ TACAATGGAATGGATTACAC
rJMFF014I24+ TACAATGGAATGGATTACACAAAAAA
rJMFF022P13+ TACAATGGAATGGATTACACAAAAAA
rJMFF046F02+ TACAATGGAATGGATTACACAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TACAATGGAATGGATTACACAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG