Previous Contig 010632:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023H07Sequence395001143 (5)gb:AB037538_15191402e-15Arabidopsis thaliana PEX14 gene, complete cds.611010632 (4)
JMFF046E24Sequence551001143 (5)gb:AB037538_15191405e-24Arabidopsis thaliana PEX14 gene, complete cds.512010632 (4)sp|Q16992|LWA_ANTEL0.006LWamide neuropeptides precursor [Contains: LWamide I; Metamorphosin A (LWamide I
JMSF004P24Sequence318001143 (5)gb:ATH251524_15521746e-04Arabidopsis thaliana mRNA for peroxin Pex14 (pex14 gene).403010632 (4)sp|Q16992|LWA_ANTEL0.005LWamide neuropeptides precursor [Contains: LWamide I; Metamorphosin A (LWamide I
JMSF032J16Sequence676001143 (5)gb:AB037538_15191402e-33Arabidopsis thaliana PEX14 gene, complete cds.791010632 (4)gb:AY088340_15733604e-10Arabidopsis thaliana clone 578 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032J16+ GTTCACAGCCATCACAGCAATTNTATGCAAATGGCNAA
                      ____________________________________________________________
consensus GTTCACAGCCATCACAGCAATTNTATGCAAATGGCNAA
 
. : . : . : . : . : . :
rJMSF032J16+ GTGGATACTGATGCACGCTCAGTAAGATCTTCATCGCCACCCACATCTGTGGAACCCCCT
                      ____________________________________________________________
consensus GTGGATACTGATGCACGCTCAGTAAGATCTTCATCGCCACCCACATCTGTGGAACCCCCT
 
. : . : . : . : . : . :
rJMSF032J16+ CCACATCCAAAATCTTACATGGAGATAATGGAAATGGTTCAAAGAGGGGAGAGACCTCCC
                      ____________________________________________________________
consensus CCACATCCAAAATCTTACATGGAGATAATGGAAATGGTTCAAAGAGGGGAGAGACCTCCC
 
. : . : . : . : . : . :
rJMSF032J16+ AACATGAGAGACATTAATGATCAACCACCGAATCCTAATCAACCCATACCTGAACCTCTA
rJMFF023H07+ TA
                      ____________________________________________________________
consensus AACATGAGAGACATTAATGATCAACCACCGAATCCTAATCAACCCATACCTGAACCTCTA
 
. : . : . : . : . : . :
rJMSF032J16+ GTAGCACCAAAGCCTAAGCCTTGGGAAGTCGGTCAAACTCAGAACAGTTCAAGCAATTTC
rJMFF023H07+ GTAGCACCAAAGCCTAAGCCTTGGGAAGTCGGTCAAACTCAGAACAGTTCAAGCAATTTC
                      ____________________________________________________________
consensus GTAGCACCAAAGCCTAAGCCTTGGGAAGTCGGTCAAACTCAGAACAGTTCAAGCAATTTC
 
. : . : . : . : . : . :
rJMSF032J16+ ATTCAATCTCAAGGCAGCGGTGATGCCTCGGGTTTCGGTTTCCAAGATAATAATCAGTTC
rJMFF023H07+ ATTCAATCTCAAGGCAGCGGTGATGCCTCGGGTTTCGGTTTCCAAGATAATAATCAGTTC
                      ____________________________________________________________
consensus ATTCAATCTCAAGGCAGCGGTGATGCCTCGGGTTTCGGTTTCCAAGATAATAATCAGTTC
 
. : . : . : . : . : . :
rJMSF032J16+ AATGGAAGCAGTTCAACCCCTTGGTGGCAACGCAAAAATGCTAGAATTACAGAAATCGAA
rJMFF023H07+ AATGGAAGCAGTTCAACCCCTTGGTGGCAACGCAAAAATGCTAGAATTACAGAAATCGAA
rJMFF046E24+ GCAACGCAAAAATGCTAGAATTACAGAAATCGAA
                      ____________________________________________________________
consensus AATGGAAGCAGTTCAACCCCTTGGTGGCAACGCAAAAATGCTAGAATTACAGAAATCGAA
 
. : . : . : . : . : . :
rJMSF032J16+ TCTGAAGATGAACAGAAGTTCGGGGGGCCTTCTGGTGTGCCAACCAACGAAAGACCTCCC
rJMFF023H07+ TCTGAAGATGAACAGAAGTTCGGGGGGCCTTCTGGTGTGCCAACCAACGAAAGACCTCCC
rJMSF004P24+ GCCAACCAACGAAAGACCTCCC
rJMFF046E24+ TCTGAAGATGAACAGAAGTTCGGGGGGCCTTCTGGTGTGCCAACCAACGAAAGACCTCCC
                      ____________________________________________________________
consensus TCTGAAGATGAACAGAAGTTCGGGGGGCCTTCTGGTGTGCCAACCAACGAAAGACCTCCC
 
. : . : . : . : . : . :
rJMSF032J16+ CCACGGTCCTGGGTTCCTCCCCAGCCACCTCCAGTTGCAATGGCCGAAGCAGCAGCAGCG
rJMFF023H07+ CCACGGTCCTGGGTTCCTCCCCAGCCACCTCCAGTTGCAATGGCCGAAGCAGCAGCAGCG
rJMSF004P24+ CCACGGTCCTGGGTTCCTCCCCAGCCACCTCCAGTTGCAATGGCCGAAGCAGCAGCAGCG
rJMFF046E24+ CCACGGTCCTGGGTTCCTCCCCAGCCACCTCCAGTTGCAATGGCCGAAGCAGCAGCAGCG
                      ____________________________________________________________
consensus CCACGGTCCTGGGTTCCTCCCCAGCCACCTCCAGTTGCAATGGCCGAAGCAGCAGCAGCG
 
. : . : . : . : . : . :
rJMSF032J16+ ATCCGACAACCTAAAAAGTCTTCGTTGCCGAAAGATCAGCTGACAGACGACCAGTTGCTG
rJMFF023H07+ ATCCGACAACCTA--AAGTCTTCGTTGCCGAAAGATCAGCTGACAGACGACCAGTTGCTG
rJMSF004P24+ ATCCGACAACCTAAAAAGTCTTCGTTGCCGAAAGATCAGCTGACAGACGACCAGTTGCTG
rJMFF046E24+ ATCCGACAACCTA--AAGTCTTCGTTGCCGAAAGATCAGCTGACAGACGACCAGTTGCTG
                      ____________________________________________________________
consensus ATCCGACAACCTAAAAAGTCTTCGTTGCCGAAAGATCAGCTGACAGACGACCAGTTGCTG
 
. : . : . : . : . : . :
rJMSF032J16+ GGGCGCTCATCGGAAATTTCTGATGACTTAGAGAGGATTACGAAGATCTCTGAATCAGGT
rJMFF023H07+ GGGCGCTCATCGGAAATTTCTGATGACTTAGAGAGGATTACAAAGATCTCTGAATCAGGT
rJMSF004P24+ GGGCGCTCATCGGAAATTTCTGATGACCTAGAGAGGATTACAAAGATCTCTGAATCAGGT
rJMFF046E24+ GGGCGCTCATCGGAAATTTCTGATGACTTAGAGAGGATTACAAAGATCTCTGAATCAGGT
                      ____________________________________________________________
consensus GGGCGCTCATCGGAAATTTCTGATGACTTAGAGAGGATTACAAAGATCTCTGAATCAGGT
 
. : . : . : . : . : . :
rJMSF032J16+ GGTTTTGGAGAAGCCAATGGTGTGACTCAGACACCATTAGCAAATGATGTGCCAGCTTTG
rJMFF023H07+ GGTTTTGGAGAAGCCAATGGTGTGACTCAGACACCATTAGCAAATGATGTGCCAGCTTTG
rJMSF004P24+ GGTTTTGGAGAAGCCAATGGTGTGACTCAGACACCATTAGCAAATGATGTGCCAGCTTTG
rJMFF046E24+ GGTTTTGGAGAAGCCAATGGTGTGACTCAGACACCATTAGCAAATGATGTGCCAGCTTTG
                      ____________________________________________________________
consensus GGTTTTGGAGAAGCCAATGGTGTGACTCAGACACCATTAGCAAATGATGTGCCAGCTTTG
 
. : . : . : . : . : . :
rJMSF032J16+ GAATAAACTAAGAAATCATATATGTTTCATTTTACTTCTTCTTCCCCCTCCCCAGGAACT
rJMFF023H07+ GAATAAACTAAGAAATCATATATGTTTCATTTTACTTCTTCTTCCCCCTCCCCAGGAACT
rJMSF004P24+ GAATAAACTAAGAAATCATATATGTTTCATTTTACTTCTTCTTCCCCCTCCCCAGGAACT
rJMFF046E24+ GAATAAACTAAGAAATCATATATGTTTCATTTTACTTCTTCTTCCCCCTCCCCAGGAACT
                      ____________________________________________________________
consensus GAATAAACTAAGAAATCATATATGTTTCATTTTACTTCTTCTTCCCCCTCCCCAGGAACT
 
. : . : . : . : . : . :
rJMSF032J16+ CAACCTCATCTTCTGCTTGTTCTGCAATTCATT
rJMFF023H07+ CAACCTCATCTTCTGCTTGTTCTGCAATTCATTATTATGGTCAATACTTGATATCATAGT
rJMSF004P24+ CAACCTCATCTTCTGCTTGTTCTGCAATTCATTATTATGGTCAATACTTGATATCATAGT
rJMFF046E24+ CAACCTCATCTTCTGCTTGTTCTGCAATTCATTATTATGGTCAATACTTGATATCATAGT
                      ____________________________________________________________
consensus CAACCTCATCTTCTGCTTGTTCTGCAATTCATTATTATGGTCAATACTTGATATCATAGT
 
. : . : . : . : . : . :
rJMFF023H07+ GTAATAATT
rJMSF004P24+ GTAATAATT
rJMFF046E24+ GTAATAATTTCCAGGTCTTCTGCCTTTTGTGGATTATATAATACCATATCTCATTTCTGG
                      ____________________________________________________________
consensus GTAATAATTTCCAGGTCTTCTGCCTTTTGTGGATTATATAATACCATATCTCATTTCTGG