Previous Contig 010623:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004P18Sequence520000235 (29)gb:AF461042_18018041e-53Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.744010623 (23)gb:AJ868542_18150871e-30Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF005N17Sequence307000235 (29)gb:AF454634_18011073e-29Lycopersicon esculentum cytochrome P450 CYP74C3 mRNA, complete cds.752010623 (23)gb:AF461042_18018044e-35Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMFF009E16Sequence472010623 (23)gb:AJ868542_18150871e-20Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF015L01Sequence660000235 (29)gb:AF461042_18018044e-67Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.649010623 (23)gb:AJ868542_18150871e-17Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF020C21Sequence589000235 (29)gb:AF461042_18018045e-60Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.684010623 (23)gb:AJ868542_18150872e-24Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF021D19Sequence517000235 (29)gb:AF454634_18011077e-53Lycopersicon esculentum cytochrome P450 CYP74C3 mRNA, complete cds.675010623 (23)gb:AF461042_18018043e-35Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMFF022I20Sequence496000235 (29)gb:AF454634_18011074e-52Lycopersicon esculentum cytochrome P450 CYP74C3 mRNA, complete cds.762010623 (23)gb:AF461042_18018041e-34Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMFF025O08Sequence588000235 (29)gb:AF461042_18018041e-60Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.769010623 (23)gb:AF461042_18018044e-35Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMFF027A24Sequence519000235 (29)gb:AF454634_18011072e-53Lycopersicon esculentum cytochrome P450 CYP74C3 mRNA, complete cds.685010623 (23)gb:AJ868542_18150873e-27Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF027C02Sequence516000235 (29)gb:AF454634_18011072e-53Lycopersicon esculentum cytochrome P450 CYP74C3 mRNA, complete cds.694010623 (23)gb:AJ868542_18150871e-22Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF027P22Sequence571000235 (29)gb:AF461042_18018043e-58Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.740010623 (23)gb:AF461042_18018042e-26Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMFF030L17Sequence587000235 (29)gb:AF461042_18018041e-60Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.703010623 (23)gb:AJ868542_18150874e-27Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF031O13Sequence516000235 (29)gb:AF081955_17665665e-51Cucumis melo fatty acid 9-hydroperoxide lyase (HPL) mRNA, complete cds.674010623 (23)gb:AJ868542_18150878e-31Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF033J02Sequence424000235 (29)gb:AY243478_15924222e-45Citrus sinensis allene oxide synthase (AOS) mRNA, complete cds.701010623 (23)gb:AJ868542_18150871e-27Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF033K18Sequence574000235 (29)gb:AF461042_18018043e-58Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.770010623 (23)gb:AJ868542_18150877e-33Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF036E14Sequence591000235 (29)gb:AF461042_18018041e-60Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.699010623 (23)gb:AJ868542_18150871e-27Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF043N01Sequence621000235 (29)gb:AF461042_18018043e-57Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.611010623 (23)gb:AJ868542_18150879e-26Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF045D19Sequence618000235 (29)gb:AF461042_18018043e-64Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.590010623 (23)gb:AF461042_18018043e-48Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMFF046C15Sequence647000235 (29)gb:AF461042_18018043e-57Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.592010623 (23)gb:AJ868542_18150872e-18Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMFF046D10Sequence478000235 (29)gb:AF461042_18018045e-51Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.453010623 (23)
JMSF003I19Sequence311000235 (29)gb:AF454634_18011074e-29Lycopersicon esculentum cytochrome P450 CYP74C3 mRNA, complete cds.740010623 (23)gb:AJ868542_18150879e-29Solanum tuberosum partial mRNA for allene oxide synthase (aos3 gene).
JMSF007I04Sequence300000235 (29)gb:AF081955_17665661e-22Cucumis melo fatty acid 9-hydroperoxide lyase (HPL) mRNA, complete cds.769010623 (23)gb:AF461042_18018043e-37Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMSF023N01Sequence663000235 (29)gb:AF461042_18018048e-68Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.762010623 (23)gb:AF461042_18018042e-39Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045D19+ GAGATCCGCGGCGCGGTGGAGCTAGAAGGCGGGAAAATCACCCTCAA
                      ____________________________________________________________
consensus GAGATCCGCGGCGCGGTGGAGCTAGAAGGCGGGAAAATCACCCTCAA
 
. : . : . : . : . : . :
rJMFF045D19+ CGCGCTAAACAACATGCCGTTAACCGAATCCGCAATCTGGGAAGCTCTCAGGATCGAACC
rJMSF023N01+ TCTGGGAAGCTTTCAGGATCGAACC
rJMFF025O08+ CTCTCAGGATCGAACC
rJMSF007I04+ ATCGAACC
                      ____________________________________________________________
consensus CGCGCTAAACAACATGCCGTTAACCGAATCCGCAATCTGGGAAGCTCTCAGGATCGAACC
 
. : . : . : . : . : . :
rJMFF045D19+ CCCTATCC-GTTACCAGTACGCTAAAG-CCAAACAGGACATCACAAT-CCAGAGCCACGA
rJMFF021D19+ CCGTTACCAGTACGCTAAAG-CCAAACAGGACATCACAAT-CCAGAGCCACGA
rJMSF023N01+ CCCTATCC-GTTACCAGTACGCTAAAG-CCAAACAGGACATCACAAT-CCAGAGCCACGA
rJMFF025O08+ CCCTATCCGGTTACCAGTACGCTAAAG-CCAAACAGGACATCACAAT-CCAGAGCCACGA
rJMFF031O13+ TACCAGTACGCTAAAG-CCAAACGGGACATCACAATCCCAGAGCCACGA
rJMFF005N17+ GTTACCAGTACGCTAAAG-CCAAACAGGACATCACAAT-CCAGAGCCACGA
rJMSF003I19+ TAAAG-CCAAACAGGACATCACAAT-CCAGAGCCACGA
rJMSF007I04+ CCCTATCC-GTTACCAGTACGCTAAAG-CCAANCAGGACATCACAAT-CCAGAGCCACGA
rJMFF022I20+ TACCAGTACGCTAAAG-CCAAACAGGACATCACAAT-CCAGAGCCACGA
rJMFF033K18+ GTTACCAGTACGCTAAAGCCCAAACAGGACATCACAAT-CCAGAGCCACGA
rJMFF027P22+ AGAGCCACGA
rJMFF004P18+ CAGAGCCACGA
                      ____________________________________________________________
consensus CCCTATCC-GTTACCAGTACGCTAAAG-CCAAACAGGACATCACAAT-CCAGAGCCACGA
 
. : . : . : . : . : . :
rJMFF045D19+ CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF021D19+ CGCNTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMSF023N01+ CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF025O08+ CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF031O13+ CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF043N01+ ATATTCGGATTCCAACCCTTCGCCACC-
rJMFF005N17+ CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMSF003I19+ CGCCTCGTACCTTATCAAGAAAGGGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMSF007I04+ CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF022I20+ CGCCTCGTNCCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCNTTCGCCACC-
rJMFF036E14+ TTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF033J02+ TTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF027A24+ CAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF030L17+ TCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF033K18+ CGCNTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
rJMFF027P22+ CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCNTTCGCCACCA
rJMFF020C21+ TCGGATTCCAACCNTTCGCCACC-
rJMFF027C02+ ATTCCANCCCTTCGCCACC-
rJMFF009E16+ C-
rJMFF004P18+ CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCNTTCGCCACC-
                      ____________________________________________________________
consensus CGCCTCGTACCTTATCAAGAAA-GGAGAAACCATATTCGGATTCCAACCCTTCGCCACC-
 
. : . : . : . : . : . :
rJMFF045D19+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF021D19+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMSF023N01+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF025O08+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF031O13+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF043N01+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF005N17+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMSF003I19+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMSF007I04+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF022I20+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF036E14+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF033J02+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF027A24+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF030L17+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF033K18+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF027P22+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF020C21+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF027C02+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF015L01+ GGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF046C15+ GAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF009E16+ AAAGATCCCAAGATTTTCGAAANCCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
rJMFF004P18+ AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
                      ____________________________________________________________
consensus AAAGATCCCAAGATTTTCGAAAACCCGGAAACGTATATCCCGGATAGATTTGTCGGGGAC
 
. : . : . : . : . : . :
rJMFF045D19+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF021D19+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMSF023N01+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF025O08+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF031O13+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF043N01+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF005N17+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMSF003I19+ GGAAAAAAGCTGGTCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMSF007I04+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF022I20+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF036E14+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF033J02+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF027A24+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF030L17+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF033K18+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF027P22+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF020C21+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF027C02+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTNTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF015L01+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF046C15+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF009E16+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
rJMFF004P18+ GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
                      ____________________________________________________________
consensus GGAAAAAAGCTGATCCAGTATGTTTACTGGTCTAATGCGAAAGGGACAGACATTCCGGGG
 
. : . : . : . : . : . :
rJMFF045D19+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF021D19+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMSF023N01+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF025O08+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF031O13+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF043N01+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF005N17+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMSF003I19+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMSF007I04+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF022I20+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGTTGTTCTTA
rJMFF036E14+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF033J02+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF027A24+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF030L17+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF033K18+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF027P22+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF020C21+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF027C02+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF015L01+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF046C15+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF009E16+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
rJMFF004P18+ GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
                      ____________________________________________________________
consensus GCGAACGACAAACAGTGTCTGGGAAGGGAAATGATTATTCTACTTTCACGGCTGTTCTTA
 
. : . : . : . : . : . :
rJMFF045D19+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF021D19+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMSF023N01+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF025O08+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF031O13+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF043N01+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF005N17+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMSF003I19+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMSF007I04+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF022I20+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF036E14+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF033J02+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF027A24+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF030L17+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF033K18+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF027P22+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF020C21+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF027C02+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF015L01+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF046C15+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF009E16+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
rJMFF004P18+ GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
                      ____________________________________________________________
consensus GCGAAGCTTTTCCTCCGTTACGATACATTCACGGTTGAAGTTTCAAAGTACTTGTTCAGC
 
. : . : . : . : . : . :
rJMFF045D19+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF021D19+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMSF023N01+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF025O08+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF031O13+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF043N01+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF005N17+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMSF003I19+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMSF007I04+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF022I20+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF036E14+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF033J02+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF027A24+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF030L17+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF033K18+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF027P22+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF020C21+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF027C02+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF015L01+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF046C15+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF009E16+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF004P18+ TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
rJMFF046D10+ AAAGTTACTTCATTTGCATAAAAGGGATTGAAC
                      ____________________________________________________________
consensus TACACCGTTACATTCAAGTCCCTAACCAAAGTTACTTCATTTGCATAAAAGGGATTGAAC
 
. : . : . : . : . : . :
rJMFF045D19+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF021D19+ TGTACGGGTCGTGTTGTGGAATCAGAGGAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMSF023N01+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF025O08+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF031O13+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF043N01+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF005N17+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMSF003I19+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMSF007I04+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF022I20+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF036E14+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF033J02+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF027A24+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF030L17+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF033K18+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF027P22+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF020C21+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF027C02+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF015L01+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF046C15+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF009E16+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF004P18+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
rJMFF046D10+ TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
                      ____________________________________________________________
consensus TGTACGGGTCGTGTTGTGGAATCAGAGAAATGCTATTCTCAACCAATAAAATAAAACTTT
 
. : . : . : . : . : . :
rJMFF045D19+ AGTTATAT
rJMFF021D19+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMSF023N01+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF025O08+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF031O13+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF043N01+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF005N17+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMSF003I19+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMSF007I04+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF022I20+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF036E14+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF033J02+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF027A24+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF030L17+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF033K18+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF027P22+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF020C21+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF027C02+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF015L01+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF046C15+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF009E16+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF004P18+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
rJMFF046D10+ AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
                      ____________________________________________________________
consensus AGTTATATATTAATGGGATCTATCTTGGGTCAAGGAACGAGGTCATGCGAAGGTCTTAAT
 
. : . : . : . : . : . :
rJMFF021D19+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMSF023N01+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF025O08+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF031O13+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF043N01+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF005N17+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMSF003I19+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMSF007I04+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF022I20+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF036E14+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF033J02+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF027A24+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF030L17+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF033K18+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF027P22+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF020C21+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF027C02+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAGTCAACTGGATCTCTCA
rJMFF015L01+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF046C15+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF009E16+ NTACTCAGACTCTCACATGGTCGCGAGAATTTGCTCCANGGCAATCAACTG
rJMFF004P18+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
rJMFF046D10+ CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
                      ____________________________________________________________
consensus CTACTCAGACTCTCACATGGTCGCGTGAATTTGCTCCATGGCAATCAACTGGATCTCTCA
 
. : . : . : . : . : . :
rJMFF021D19+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMSF023N01+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF025O08+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF031O13+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF043N01+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF005N17+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMSF003I19+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMSF007I04+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF022I20+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF036E14+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF033J02+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF027A24+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF030L17+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF033K18+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF027P22+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF020C21+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF027C02+ TTTTCAGGTTGTGTTGCGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF015L01+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF046C15+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF004P18+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
rJMFF046D10+ TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
                      ____________________________________________________________
consensus TTTTCAGGTTGTGTTACGTTATTAATAATTGTCGTCTGTTTCGTCGACACTTTGAATATT
 
. : . : . : . : . : . :
rJMFF021D19+ TGTATGTTTCTAGATTAGCGAATAAG
rJMSF023N01+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF025O08+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF031O13+ TGTATGTTTCTAGATTAGCGAATAAGAT
rJMFF043N01+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCT
rJMFF005N17+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMSF003I19+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTATGGCGCGCTGTTCGT
rJMSF007I04+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF022I20+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF036E14+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF033J02+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF027A24+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF030L17+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF033K18+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF027P22+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF020C21+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF027C02+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF015L01+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF046C15+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTA
rJMFF004P18+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
rJMFF046D10+ TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
                      ____________________________________________________________
consensus TGTATGTTTCTAGATTAGCGAATAAGATTGCCCATATGTTAGCTAGGGCGCGCTGTTCGT
 
. : . : . : . : . : . :
rJMSF023N01+ ACTCCGTCTGGTCCGTT
rJMFF025O08+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATA
rJMFF005N17+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGAT
rJMSF003I19+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTA
rJMSF007I04+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTAT
rJMFF022I20+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTNTTGTAT
rJMFF036E14+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATT
rJMFF033J02+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTAT
rJMFF027A24+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCC
rJMFF030L17+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTAT
rJMFF033K18+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATTGAAATTTA
rJMFF027P22+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATTGAAATTTA
rJMFF020C21+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATTGAAATTTA
rJMFF027C02+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATTGAAATTTA
rJMFF015L01+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATTGAAATTTA
rJMFF004P18+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATTGAAATTTA
rJMFF046D10+ ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATTGAAATTTA
                      ____________________________________________________________
consensus ACTCCGTCTGGTCCGTTTATTTGGCATTCTATATATGATTCCTTATTGTATTGAAATTTA
 
. : . : . : . : . : . :
rJMFF033K18+ AT
rJMFF027P22+ ATT
rJMFF020C21+ A
rJMFF027C02+ ATTTAATAAAGTTTT
rJMFF015L01+ ATTTAATAAAGTTTT
rJMFF004P18+ ATTTAATAAAGTTTT
rJMFF046D10+ ATTTAATAAAGTTTTTTGGGTTGGTTTTCXXXXXXXXXXXXXXXXXXXXCTCTCCAGGGT
                      ____________________________________________________________
consensus ATTTAATAAAGTTTTTTGGGTTGGTTTTCNNNNNNNNNNNNNNNNNNNNCTCTCCAGGGT