Previous Contig 010622:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014C09Sequence580000736 (3)gb:BT004254_16373368e-66Arabidopsis thaliana clone RAFL15-07-P19 (R20510) putative amino acid acetyltran706010622 (5)gb:BT004254_16373365e-59Arabidopsis thaliana clone RAFL15-07-P19 (R20510) putative amino acid acetyltran
JMFF046D08Sequence454000736 (3)pir|T04724|T047242e-58hypothetical protein F19F18.160 - Arabidopsis thaliana>gb:ATCHRIV87_1547721 Arab417010622 (5)gb:BT004254_16373364e-07Arabidopsis thaliana clone RAFL15-07-P19 (R20510) putative amino acid acetyltran
JMFF050O05Sequence638000736 (3)gb:BT004254_16373361e-70Arabidopsis thaliana clone RAFL15-07-P19 (R20510) putative amino acid acetyltran637010622 (5)gb:BT004254_16373362e-44Arabidopsis thaliana clone RAFL15-07-P19 (R20510) putative amino acid acetyltran
JMSF009L11Sequence378018638gb:AP003803_18335951e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10772010622 (5)gb:BT004254_16373367e-88Arabidopsis thaliana clone RAFL15-07-P19 (R20510) putative amino acid acetyltran
JMSF017G12Sequence493002997 (2)gb:AP003803_18335955e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10795010622 (5)gb:BT004254_16373361e-74Arabidopsis thaliana clone RAFL15-07-P19 (R20510) putative amino acid acetyltran

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009L11+ AGAATTAGCAG
                      ____________________________________________________________
consensus AGAATTAGCAG
 
. : . : . : . : . : . :
rJMSF009L11+ CTGCAGCTTTTGTTTGCAGAGGTGGGGTTCAAAGAGTTCATCTGTTGGATGGCACTATTG
rJMSF017G12+ GATGGCACCATTG
                      ____________________________________________________________
consensus CTGCAGCTTTTGTTTGCAGAGGTGGGGTTCAAAGAGTTCATCTGTTGGATGGCACTATTG
 
. : . : . : . : . : . :
rJMSF009L11+ GTGGAGNTTTACTTAAGGAATTGTTTCAAAGAGATGGAGTTGGTACAATGGTGGCTAGTG
rJMSF017G12+ GTGGCGTTTTATTGAAGGAGTTGTTCCAAAGAGATGGAGTTGGTACAATGGTGGCTAGTG
                      ____________________________________________________________
consensus GTGGCGTTTTATTTAAGGAGTTGTTTCAAAGAGATGGAGTTGGTACAATGGTGGCTAGTG
 
. : . : . : . : . : . :
rJMSF009L11+ ACCTTTATGAAGGAACAAGAATGGCAAGAACAGATGATATTCCTGGAATAAAACAGTTAT
rJMSF017G12+ ACCTTTATGAAGGAACACGAATGGCAAGGGCAACAGATATTCCTGGAATAAAACAAATAT
rJMFF014C09+ CAACAGATATTCCTGGAATAAAACAAATAT
                      ____________________________________________________________
consensus ACCTTTATGAAGGAACACGAATGGCAAGGGCAACAGATATTCCTGGAATAAAACAAATAT
 
. : . : . : . : . : . :
rJMSF009L11+ TGCAGCCTCTAGAAGAGTCTGGGACTTTGATAAGGAGGACAGAGGAAGAGCTACTCGACA
rJMSF017G12+ TGCAACCTTTAGAAGAGTTTGGAACATTGATCAGGAGGACTGAGGTAGAGCTTCTTGAGG
rJMFF014C09+ TGCAACCTTTAGAAGAGTTTGGAACATTGATCAGGAGGACTGAGGTAGAGCTTCTTGAGG
                      ____________________________________________________________
consensus TGCAACCTTTAGAAGAGTTTGGAACATTGATCAGGAGGACTGAGGTAGAGCTTCTTGAGG
 
. : . : . : . : . : . :
rJMSF009L11+ TGTTGGATTCATTCATTGTTATGGAGAGGGAAGGTCAAATTATAGCATGCGCTGCTCTCA
rJMSF017G12+ CCTTGGATTCATTCATTGTTGTGGAAAGAGAGGGTCAAATTATAGCTTGTGCTGCTCTCT
rJMFF014C09+ CCTTGGATTCATTCATTGTTGTGGAAAGAGAGGGTCAAATTATAGCTTGTGCTGCTCTCT
rJMFF050O05+ GAAAGAGAGGGTCAAATTATAGCTTGTGCTGCTCTCT
                      ____________________________________________________________
consensus CCTTGGATTCATTCATTGTTGTGGAAAGAGAGGGTCAAATTATAGCTTGTGCTGCTCTCT
 
. : . : . : . : . : . :
rJMSF009L11+ TTCCACACTACAAAGAAAAATGTGGAGAGGTTGCTGCTATTGCTGTTTCTCCAGATTGCC
rJMSF017G12+ TTCCATACTTAAAAGAAAAATGTGGAGAGGTTGCTTCTATTGCTGTTTCTCCTGATTGTC
rJMFF014C09+ TTCCATACTTAAAAGAAAAATGTGGAGAGGTTGCTTCTATTGCTGTTTCTCCTGATTGTC
rJMFF050O05+ TTCCATACTTAAAAGAAAAATGTGGAGAGGTTGCTTCTATTGCTGTTTCTCCTGATTGTC
                      ____________________________________________________________
consensus TTCCATACTTAAAAGAAAAATGTGGAGAGGTTGCTTCTATTGCTGTTTCTCCTGATTGTC
 
. : . : . : . : . : . :
rJMSF009L11+ GTGGCCAAGGAAAGGGAGATAAATTACTCGATTACGTTGAGAAGAAAGCATGTTCTCTTG
rJMSF017G12+ GAGGTCAAGGACAAGGAGACAAATTACTTGATTACATTGAAAAGAAGGCATCTTCCCATG
rJMFF014C09+ GAGGTCAAGGACAAGGAGACAAATTACTTGATTACATTGAAAAGAAGGCATCTTCCCATG
rJMFF050O05+ GAGGTCAAGGACAAGGAGACAAATTACTTGATTACATTGAAAAGAAGGCATCTTCCCATG
                      ____________________________________________________________
consensus GAGGTCAAGGACAAGGAGACAAATTACTTGATTACATTGAAAAGAAGGCATCTTCCCATG
 
. : . : . : . : . : . :
rJMSF009L11+ GACTGGAAATGCTCTTCCTCCTCACTACTCGCACAGCTGACTGGTTTATAAGGCGTGGGT
rJMSF017G12+ GGATTCAAAAGCTGTTTCTCCTTACAACTCGAACAGCAGACTGGTTTATAAGGCGTGGCT
rJMFF014C09+ GGATTCAAAAGCTGTTTCTCCTTACAACTCGAACAGCAGACTGGTTTATAAGGCGTGGCT
rJMFF050O05+ GGATTCAAAAGCTGTTTCTCCTTACAACTCGAACAGCAGACTGGTTTATAAGGCGTGGCT
                      ____________________________________________________________
consensus GGATTCAAAAGCTGTTTCTCCTTACAACTCGAACAGCAGACTGGTTTATAAGGCGTGGCT
 
. : . : . : . : . : . :
rJMSF009L11+ TCTCAGAATGTTCCATTGACAATATACCAGAGGAAAGAAGGAAGAAGATCAATCTCTCGC
rJMSF017G12+ TTTCAGAATGTTCCATTGATCAGTTACCAGTGGAGAGAAGGAAAAAAATCAACCTTTCAC
rJMFF014C09+ TTTCAGAATGTTCCATTGATCAGTTACCAGTGGAGAGAAGGAAAAAAATCAACCTTTCAC
rJMFF050O05+ TTTCAGAATGTTCCATTGATCAGTTACCAGTGGAGAGAAGGAAAAAAATCAACCTTTCAC
rJMFF046D08+ CAGAATGTTCCATTGATCAGTTACCAGTGGAGAGAAGGAAAAAAATCAACCTTTCAC
                      ____________________________________________________________
consensus TTTCAGAATGTTCCATTGATCAGTTACCAGTGGAGAGAAGGAAAAAAATCAACCTTTCAC
 
. : . : . : . : . : . :
rJMSF009L11+ GTAGATCAAAATATTACATGAAGAAGCTGCTACCTGATAGGAGTGGTATTCGC
rJMSF017G12+ GTGGATCAAAATATTACATGAAGAAGCTGCAGCCTGATAGGAGCGGTATTCGCTTTGGTA
rJMFF014C09+ GTGGATCAAAATATTACATGAAGAAGCTGCAGCCTGATAGGAGCGGTATTCGCTTTGGTA
rJMFF050O05+ GTGGATCAAAATATTACATGAAGAAGCTGCAGCCTGATAGGAGCGGTATTCGCTTTGGTA
rJMFF046D08+ GTGGATCAAAATATTACATGAAGAAGCTGCAGCCTGATAGGAGCGGTATTCGCTTTGGTA
                      ____________________________________________________________
consensus GTGGATCAAAATATTACATGAAGAAGCTGCAGCCTGATAGGAGCGGTATTCGCTTTGGTA
 
. : . : . : . : . : . :
rJMSF017G12+ GTGTTATTGCGTAAGAGCAAAATAGAGGATTATTATGCCCACATAATTGGCTGTACTGTG
rJMFF014C09+ GTGTTATTGCGTAAGAGCAAAATAGAGGATTATTATGCCCACATAATTGGCTGTACTGTG
rJMFF050O05+ GTGTTATTGCGTAAGAGCAAAATAGAGGATTATTATGCCCACATAATTGGCTGTACTGTG
rJMFF046D08+ GTGTTATTGCGTAAGAGCAAAATAGAGGATTATTATGCCCACATAATTGGCTGTACTGTG
                      ____________________________________________________________
consensus GTGTTATTGCGTAAGAGCAAAATAGAGGATTATTATGCCCACATAATTGGCTGTACTGTG
 
. : . : . : . : . : . :
rJMSF017G12+ AGCTAAAGCTTGTAGCAGTGTCTCTGTAACTGAGAAGCTGAATTAAGAAGACGTAATGTT
rJMFF014C09+ AGCTAAAGCTTGTAGCAGTGTCTCTGTAACTGAGAAGCTGAATTAAGAAGACGTAATGTT
rJMFF050O05+ AGCTAAAGCTTGTAGCAGTGTCTCTGTAACTGAGAAGCTGAATTAAGAAGACGTAATGTT
rJMFF046D08+ AGCTAAAGCTTGTAGCAGTGTCTCTGTAACTGAGAAGCTGAATTAAGAAGACGTAATGTT
                      ____________________________________________________________
consensus AGCTAAAGCTTGTAGCAGTGTCTCTGTAACTGAGAAGCTGAATTAAGAAGACGTAATGTT
 
. : . : . : . : . : . :
rJMSF017G12+ CAAGGAGATAGAACACAAGATGCCAAAATGCAGAGGTTGGGCATGAGATAAAAATTCATG
rJMFF014C09+ CAAGGAGATAGAACACAAGATGCCAAAATGCAGAGGTTGGGCATGAGATAAAAATTCATG
rJMFF050O05+ CAAGGAGATAGAACACAAGATGCCAAAATGCAGAGGTTGGGCATGAGATAAAAATTCATG
rJMFF046D08+ CAAGGAGATAGAACACAAGATGCCAAAATGCAGAGGTTGGGCATGAGATAAAAATTCATG
                      ____________________________________________________________
consensus CAAGGAGATAGAACACAAGATGCCAAAATGCAGAGGTTGGGCATGAGATAAAAATTCATG
 
. : . : . : . : . : . :
rJMSF017G12+ TCTTGCCAAATAATATGTTTGGATATGAAACAATTGTGATTTTTTGTGTCCTAT
rJMFF014C09+ TCTTGCCAAATAATATGTTTGGATATGAAACAATTGTGATTTTTTGTGTCCTATTGACTC
rJMFF050O05+ TCTTGCCAAATAATATGTTTGGATATGAAACAATTGTGATTTTTTGTGTCCTATTGACTC
rJMFF046D08+ TCTTGCCAAATAATATGTTTGGATATGAAACAATTGTGAGTTTTTGTGTCCTATTGACTC
                      ____________________________________________________________
consensus TCTTGCCAAATAATATGTTTGGATATGAAACAATTGTGATTTTTTGTGTCCTATTGACTC
 
. : . : . : . : . : . :
rJMFF014C09+ TATTACAAAATAGT
rJMFF050O05+ TATTACAAAATAGTATTGTTCTATAGTTTCTTTAAAAAAAAAAAAAAAACTCTCCAGGGT
rJMFF046D08+ TATTACAAAATAGTATTGTTCTATAGTTTCTTTAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TATTACAAAATAGTATTGTTCTATAGTTTCTTTAAAAAAAAAAAAAAAACTCTCCAGGGT