Previous Contig 010620:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046D02Sequence490006799 (6)347010620 (2)
JMSF032C19Sequence645006799 (6)782010620 (2)gb:AP003349_18285111e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032C19+ TTCAAGGTAAA
                      ____________________________________________________________
consensus TTCAAGGTAAA
 
. : . : . : . : . : . :
rJMSF032C19+ NTAGACGGGGAAAAGATTCAGCAACCTGTCCTCCGAGAGGAGGTTGAGTTCAGAAAGATT
                      ____________________________________________________________
consensus NTAGACGGGGAAAAGATTCAGCAACCTGTCCTCCGAGAGGAGGTTGAGTTCAGAAAGATT
 
. : . : . : . : . : . :
rJMSF032C19+ GGGCTTCAAGTTGTTTCTGGACTATGCGGGGAGCTTACCAATGCCAAGAAAGCTGCTACC
                      ____________________________________________________________
consensus GGGCTTCAAGTTGTTTCTGGACTATGCGGGGAGCTTACCAATGCCAAGAAAGCTGCTACC
 
. : . : . : . : . : . :
rJMSF032C19+ ATGGACTCGGAGGTTCTCACTAACGAAGTTGCAAAATTAGCCGATGGAGTTGCCAAGATT
                      ____________________________________________________________
consensus ATGGACTCGGAGGTTCTCACTAACGAAGTTGCAAAATTAGCCGATGGAGTTGCCAAGATT
 
. : . : . : . : . : . :
rJMSF032C19+ GCTGAAGTAGTGAGGTTGAACGAAGAAGTGGCACTCAAGGAGAACAACCGGAATTTTTCT
                      ____________________________________________________________
consensus GCTGAAGTAGTGAGGTTGAACGAAGAAGTGGCACTCAAGGAGAACAACCGGAATTTTTCT
 
. : . : . : . : . : . :
rJMSF032C19+ GAGTCAATGAATGCCTTCCTAAAGAAGGCGAAAGTAGAAATCACGAGTATTCAATCCCAG
                      ____________________________________________________________
consensus GAGTCAATGAATGCCTTCCTAAAGAAGGCGAAAGTAGAAATCACGAGTATTCAATCCCAG
 
. : . : . : . : . : . :
rJMSF032C19+ GAAGACACAGCTCTCTCCATGGTGAAGGAGTTGACAGAATACTTCCATGGTGACTTGGCT
                      ____________________________________________________________
consensus GAAGACACAGCTCTCTCCATGGTGAAGGAGTTGACAGAATACTTCCATGGTGACTTGGCT
 
. : . : . : . : . : . :
rJMSF032C19+ AAAGAAGAAGCTCATCCCTTCCGCATTTTCATGGTTGTTAGGGACTTCCTTTCCATCCTC
                      ____________________________________________________________
consensus AAAGAAGAAGCTCATCCCTTCCGCATTTTCATGGTTGTTAGGGACTTCCTTTCCATCCTC
 
. : . : . : . : . : . :
rJMSF032C19+ GATCAGGTATGCAAAGATGTCGGCAAGATAAACGAACGAACCATAGTCAGCTCAGGCCGC
                      ____________________________________________________________
consensus GATCAGGTATGCAAAGATGTCGGCAAGATAAACGAACGAACCATAGTCAGCTCAGGCCGC
 
. : . : . : . : . : . :
rJMSF032C19+ CAATTCCCAATCCCAGTCAATGCAGCGCTCCCGCTGGTTTTCCCAGGATACCTCGAGAAA
rJMFF046D02+ CAGTCAATGCAGCGCTCCCGCTGGTTTTCCCAGGATACCTCGAGAAA
                      ____________________________________________________________
consensus CAATTCCCAATCCCAGTCAATGCAGCGCTCCCGCTGGTTTTCCCAGGATACCTCGAGAAA
 
. : . : . : . : . : . :
rJMSF032C19+ CACCATGATACATCCTCGTCTGACGATGAAAGCTCCTCCTCAACTGTGTAGTTAGGTGAC
rJMFF046D02+ CACCATGATACATCCTCGTCTGACGATGAAAGCTCCTCCTCAACTGTGTAGTTAGGTGAC
                      ____________________________________________________________
consensus CACCATGATACATCCTCGTCTGACGATGAAAGCTCCTCCTCAACTGTGTAGTTAGGTGAC
 
. : . : . : . : . : . :
rJMSF032C19+ TTTCTTGTATAGCTGAACCCCAGAACAGGGCAATGAATGGGGGTTTTCCTTTTGATGCCT
rJMFF046D02+ TTTCTTGTATAGCTGAACCCCAGAACAGGGCAATGAATGGGGGTTTTCCTTTTGATGCCT
                      ____________________________________________________________
consensus TTTCTTGTATAGCTGAACCCCAGAACAGGGCAATGAATGGGGGTTTTCCTTTTGATGCCT
 
. : . : . : . : . : . :
rJMSF032C19+ GGATTCAATTTCGCCTTTTGGTTTTTACATGTTCTTGGAATCATAGTATGTAACATAAGT
rJMFF046D02+ GGATTCAATTTCGCCTTTTGGTTTTTACATGTTCTTGGAATCATAGTATGTAACATAAGT
                      ____________________________________________________________
consensus GGATTCAATTTCGCCTTTTGGTTTTTACATGTTCTTGGAATCATAGTATGTAACATAAGT
 
. : . : . : . : . : . :
rJMSF032C19+ AGAAGGTAAACAAACATGTTACTCCTATCAAACAGTATTATGGTATT
rJMFF046D02+ AGAAGGTAAACAAACATGTTACTCCTATCAAACAGTATTATGGTATTTGATCTATATGGC
                      ____________________________________________________________
consensus AGAAGGTAAACAAACATGTTACTCCTATCAAACAGTATTATGGTATTTGATCTATATGGC
 
. : . : . : . : . : . :
rJMFF046D02+ CTGTGAGTTAACTTGTAAATTTTCCAGAAACAGCAGTTATAATCCAGTATCTCCTTGAAG
                      ____________________________________________________________
consensus CTGTGAGTTAACTTGTAAATTTTCCAGAAACAGCAGTTATAATCCAGTATCTCCTTGAAG