Previous Contig 010615:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046C06Sequence603001971 (2)gb:AB026647_15172037e-34Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.530010615 (3)gb:AY062730_15653860.010Arabidopsis thaliana Unknown protein (At2g19870; F6F22.10) mRNA, complete cds.>g
JMSF013B14Sequence489001971 (2)gb:AB026647_15172031e-20Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.728010615 (3)gb:AY062730_15653861e-06Arabidopsis thaliana Unknown protein (At2g19870; F6F22.10) mRNA, complete cds.>g
JMSF014B14Sequence134010615 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013B14+ ACTGCAGTGGTGGTGCTATGTGCCAACTTTGCTCC
                      ____________________________________________________________
consensus ACTGCAGTGGTGGTGCTATGTGCCAACTTTGCTCC
 
. : . : . : . : . : . :
rJMSF013B14+ ATTAAGTGGAGCTGTGGGCAAAGTGAGTCCAGGCTCTCTTGAATTAGTGGATGTTAGATA
                      ____________________________________________________________
consensus ATTAAGTGGAGCTGTGGGCAAAGTGAGTCCAGGCTCTCTTGAATTAGTGGATGTTAGATA
 
. : . : . : . : . : . :
rJMSF013B14+ TTGCAAGAACACTGAACTTTTTGGCATCTTCAGCTGTTTGGAGGTTATACGAGTCTCACT
                      ____________________________________________________________
consensus TTGCAAGAACACTGAACTTTTTGGCATCTTCAGCTGTTTGGAGGTTATACGAGTCTCACT
 
. : . : . : . : . : . :
rJMSF014B14+ TTCAAGAGTCATTCCCTNGGATGANNTGTGCATGGTGTTCNTACAATNTTTATCTTN
rJMSF013B14+ ATGTTCAAGAGTCATTCCCTTGGATGAGCTGTGCCTGGTGTTCCTACAATCTTTATTTTG
                      ____________________________________________________________
consensus ATGTTCAAGAGTCATTCCCTTGGATGAGCTGTGCCTGGTGTTCCTACAATCTTTATTTTG
 
. : . : . : . : . : . :
rJMSF014B14+ GGCAGTGAAGNCANTAGTGTGGTTGATGAGGGNAAACTGCAGCCACAACTCGAGGTGNGC
rJMSF013B14+ GGCAGTGAAGGCACTAGTGTGGTTGATGAGGGAAAACTGCAGCCACAACTCGAGGTGTGC
                      ____________________________________________________________
consensus GGCAGTGAAGGCACTAGTGTGGTTGATGAGGGAAAACTGCAGCCACAACTCGAGGTGTGC
 
. : . : . : . : . : . :
rJMSF014B14+ ANTGGGTAAAC
rJMSF013B14+ ACTGGGTAAACCTCGTCCTGTAACTCTAGTTGGCAAAGGATTACAAGGAGGTAAACCAGC
rJMFF046C06+ CCTCGTCCTGTAACTCTAGTGGGCAAAGGATTACAAGGAGGTAAACCAGC
                      ____________________________________________________________
consensus ACTGGGTAAACCTCGTCCTGTAACTCTAGTTGGCAAAGGATTACAAGGAGGTAAACCAGC
 
. : . : . : . : . : . :
rJMSF013B14+ TTAGGTTGTCGCCCATAGTTGACCCACTCAAACCAAGAAGGGTGGGATTTGAACTCGTGA
rJMFF046C06+ TTAGGTTGTCGCCCATAGTTGACCCACTCAAACCAAGAAGGGTGGGATTTGAACTCGTGA
                      ____________________________________________________________
consensus TTAGGTTGTCGCCCATAGTTGACCCACTCAAACCAAGAAGGGTGGGATTTGAACTCGTGA
 
. : . : . : . : . : . :
rJMSF013B14+ TCTTGTGATTACAAGTCTTTATCCTTAACCAATTTGGCTGGAGTTATCCCATGAAGGCAC
rJMFF046C06+ TCTTGTGATTACAAGTCTTTATCCTTAACCAATTTGGCTGGAGTTATCCCATGAAGGCAC
                      ____________________________________________________________
consensus TCTTGTGATTACAAGTCTTTATCCTTAACCAATTTGGCTGGAGTTATCCCATGAAGGCAC
 
. : . : . : . : . : . :
rJMSF013B14+ TAGTTTGAGGTTATTTGTAGCAAGGTCTGTGCTAAGTTATTTATAATTCCATGAATCATA
rJMFF046C06+ TAGTTTGAGGTTATTTGTAGCAAGGTCTGTGCTAAGTTATTTATAATTCCATGAATCATA
                      ____________________________________________________________
consensus TAGTTTGAGGTTATTTGTAGCAAGGTCTGTGCTAAGTTATTTATAATTCCATGAATCATA
 
. : . : . : . : . : . :
rJMSF013B14+ CCTGTGGATATAATTGCTAAGGGGTGACGAAGATGTGACAGATGATGGTTGTTCAGGTCC
rJMFF046C06+ CCTGTGGATATAATTGCTAAGGGGTGACGAAGATGTGACAGATGATGGTTGTTCAGGTCC
                      ____________________________________________________________
consensus CCTGTGGATATAATTGCTAAGGGGTGACGAAGATGTGACAGATGATGGTTGTTCAGGTCC
 
. : . : . : . : . : . :
rJMSF013B14+ CAGCTTCAAGTCCTTCATGGCTATAAAGAGCTTGAACATTGGTTTTGCAGCAGGTGCACT
rJMFF046C06+ CAGCTTCAAGTCCTTCATGGCTATAAAGAGCTTGAACATTGGTTTTGCAGCAGGTGCACT
                      ____________________________________________________________
consensus CAGCTTCAAGTCCTTCATGGCTATAAAGAGCTTGAACATTGGTTTTGCAGCAGGTGCACT
 
. : . : . : . : . : . :
rJMSF013B14+ TCTTCATCTTGATAGGTGGGAACTGCATGAAAAGTAACCATCACAAGAAAGAACACTGAT
rJMFF046C06+ TCTTCATCTTGATAGGTGGGAACTGCATGAAAAGTAACCATCACAAGAAAGAACACTGAT
                      ____________________________________________________________
consensus TCTTCATCTTGATAGGTGGGAACTGCATGAAAAGTAACCATCACAAGAAAGAACACTGAT
 
. : . : . : . : . : . :
rJMSF013B14+ ATTTGTAATTTCTTCTTAAAACAAACTAATTTG
rJMFF046C06+ ATTTGTAATTTCTTCTTAAAACAAACTAATTTGCTGACATCTGAAAAGTGAAAATTCCTA
                      ____________________________________________________________
consensus ATTTGTAATTTCTTCTTAAAACAAACTAATTTGCTGACATCTGAAAAGTGAAAATTCCTA
 
. : . : . : . : . : . :
rJMFF046C06+ ATTGCGCAATTGTTATTTATATTATCAAAAGAAATGTTTTAGAAGTACAAAAAAAAAAAG
                      ____________________________________________________________
consensus ATTGCGCAATTGTTATTTATATTATCAAAAGAAATGTTTTAGAAGTACAAAAAAAAAAAG