Previous Contig 010603:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009M18Sequence517001965 (9)pir|T51575|T515756e-282-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554754010603 (9)gb:AY233204_15916826e-81Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF024K11Sequence436001965 (9)pir|T51575|T515752e-392-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554752010603 (9)gb:AY233204_15916823e-69Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF025B12Sequence511001965 (9)pir|T51575|T515755e-532-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554767010603 (9)gb:AY233204_15916829e-75Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF034E03Sequence543001965 (9)pir|T51575|T515755e-632-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554684010603 (9)gb:AY233204_15916825e-72Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF039F21Sequence560001965 (9)pir|T51575|T515757e-372-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554802010603 (9)gb:AY233204_15916823e-83Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF046A08Sequence570001965 (9)gb:ATH278629_15522654e-26Arabidopsis thaliana mRNA for Oxalyl-CoA decarboxylase (ocd gene).596010603 (9)gb:AY233204_15916821e-32Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFN018H21Sequence615010603 (9)gb:ATH278629_15522655e-92Arabidopsis thaliana mRNA for Oxalyl-CoA decarboxylase (ocd gene).
JMSF014C07Sequence487001965 (9)pir|T51575|T515751e-492-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554787010603 (9)gb:AY233204_15916828e-87Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMSF038N09Sequence607001965 (9)pir|T51575|T515755e-662-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554922010603 (9)gb:ATH278629_15522655e-98Arabidopsis thaliana mRNA for Oxalyl-CoA decarboxylase (ocd gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018H21- GAAAACTAAGGAAAAT
                      ____________________________________________________________
consensus GAAAACTAAGGAAAAT
 
. : . : . : . : . : . :
JMFN018H21- GTGTCAAAGATGGAGGCACAATTAGCCAAGGATGTTGTGCCGTTTAACTTCATGACTCCA
rJMSF038N09+ AATTAGCCAAGGATGTTGTGCCGTTTAACTTCATGACTCCA
                      ____________________________________________________________
consensus GTGTCAAAGATGGAGGCACAATTAGCCAAGGATGTTGTGCCGTTTAACTTCATGACTCCA
 
. : . : . : . : . : . :
JMFN018H21- ATGAGGATTATTAGAGACGCAATCTTGGAATTGGGTAGTCCCGCCCCAA-TTTTGTTGTC
rJMFF039F21+ ATTAGAGACGCAATCTTGGAATTGGGTAGTCCCGCCCCAATTTTTGGTGTC
rJMFF009M18+ C
rJMSF038N09+ ATGAGGATTATTAGAGACGCAATCTTGGAATTGGGTAGTCCCGCCCCAA-TTTTGGTGTC
                      ____________________________________________________________
consensus ATGAGGATTATTAGAGACGCAATCTTGGAATTGGGTAGTCCCGCCCCAA-TTTTGGTGTC
 
. : . : . : . : . : . :
JMFN018H21- TGAAGGAGCG-AATACAATGGATATTGGCAGAT-CCGTGTTGGTACAGACCGAGCCAA-G
rJMSF014C07+ GAAGGAGCG-AATACAATGGATATTGGCAGAT-CCGTGTTGGTACAGACCGAGCCAA-G
rJMFF039F21+ TGAAGGAGCG-AATACAATGGATATTGGCAGAT-CCGTGTTGGTACAGACCGAGCCCAAG
rJMFF009M18+ TGAAGGAGCGAAATACAATGGATATTGGCAGATCCCGTGTTGGTACAGACCGAGCCAAGG
rJMSF038N09+ TGAAGGAGCG-AATACAATGGATATTGGCAGAT-CCGTGTTGGTACAGACCGAGCCAA-G
                      ____________________________________________________________
consensus TGAAGGAGCG-AATACAATGGATATTGGCAGAT-CCGTGTTGGTACAGACCGAGCCAA-G
 
. : . : . : . : . : . :
JMFN018H21- GACTCGGTTGGATGCGGGGACTTGGGGAACAATGGGGGTTGGTCTCGGATATTGCATTGC
rJMFF034E03+ CTCGGATATTGCATTGC
rJMSF014C07+ GACTCGGTTGGATGCGGGGACTTGGGGAACAATGGGGGTTGGTCTCGGATATTGCATTGC
rJMFF039F21+ GACTCGGTTGGATGCGGGGACTTGGGGAACAATGGGGGTTGGTCTCGGATATTGCATTGC
rJMFF009M18+ GACTCGGTTGGATGCGGGGACTTGGGGANCAATGGGGGTTGGTCTCGGATATTGCATTGC
rJMSF038N09+ GACTCGGTTGGATGCGGGGACTTGGGAAACAATGGGGGTTGGTCTCGGATATTGCATTGC
rJMFF025B12+ TGCGGGGACTTGGGGAACAATGGGGGTTGGTCTCGGATATTGCATTGC
rJMFF024K11+ CAATGGGGGTTGGTCTCGGATATTGCATTGC
                      ____________________________________________________________
consensus GACTCGGTTGGATGCGGGGACTTGGGGAACAATGGGGGTTGGTCTCGGATATTGCATTGC
 
. : . : . : . : . : . :
JMFN018H21- TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACT-CCGGATTCG
rJMFF034E03+ TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACT-CCGGATTCG
rJMSF014C07+ TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACT-CCGGATTCG
rJMFF039F21+ TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACT-CCGGATTCG
rJMFF009M18+ TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACT-CCGGATTCG
rJMSF038N09+ TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACT-CCGGATTCG
rJMFF025B12+ TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACT-CCGGATTCG
rJMFF024K11+ TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACTCCCGGATTCG
                      ____________________________________________________________
consensus TGCTGCAGTGGCGTCGCCTGAGAGGCTTGTTGTAGCTGTTGAAGGGGACT-CCGGATTCG
 
. : . : . : . : . : . :
JMFN018H21- GGTTCAGTGCTATGGAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
rJMFF034E03+ GGTTCAGTGCTATGCAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
rJMSF014C07+ GGTTCAGTGCTATGGAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
rJMFF039F21+ GGTTCAGTGCTATGGAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
rJMFF009M18+ GGTTCAGTGCTATGGAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
rJMSF038N09+ GGTTCAGTGCTATGGAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
rJMFF025B12+ GGTTCAGTGCTATGGAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
rJMFF024K11+ GGTTCAGTGCTATGGAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
                      ____________________________________________________________
consensus GGTTCAGTGCTATGGAAGTTGAGACATTGGTTAGATATCAGCTGCCCGTAGTGGTTATAG
 
. : . : . : . : . : . :
JMFN018H21- TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAG-AAATAACTGGA
rJMFF034E03+ TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAG-AAATAACTGGA
rJMSF014C07+ TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAG-AAATAACTGGA
rJMFF039F21+ TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAG-AAATAACTGGA
rJMFF009M18+ TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAG-AAATAACTGGA
rJMSF038N09+ TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAG-AAATAACTGGA
rJMFF025B12+ TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAGAAAATAACTGGA
rJMFF024K11+ TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAG-AAATAACTGGA
                      ____________________________________________________________
consensus TGTTTAACAACGGTGGTGTCTATGGTGGTGACAGAAGGAACCCCGAAG-AAATAACTGGA
 
. : . : . : . : . : . :
JMFN018H21- CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
rJMFF034E03+ CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
rJMSF014C07+ CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
rJMFF039F21+ CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
rJMFF009M18+ CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
rJMSF038N09+ CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
rJMFF025B12+ CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
rJMFF024K11+ CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
rJMFF046A08+ TACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTNTG
                      ____________________________________________________________
consensus CCTTACAAAGATGATCCAGCACCCACTTCTTTTGTCCCCGGTGCTGCGTATCATGTTTTG
 
. : . : . : . : . : . :
JMFN018H21- ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
rJMFF034E03+ ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
rJMSF014C07+ ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
rJMFF039F21+ ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
rJMFF009M18+ ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
rJMSF038N09+ ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
rJMFF025B12+ ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
rJMFF024K11+ ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
rJMFF046A08+ ATNGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
                      ____________________________________________________________
consensus ATTGAAGCGTTTGGGGGAAAAGGTTATCTTGTTGGGACCCCGGATGAACTGAAATCGGCA
 
. : . : . : . : . : . :
JMFN018H21- CTTGCCGAATCCTTTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
rJMFF034E03+ CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
rJMSF014C07+ CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
rJMFF039F21+ CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
rJMFF009M18+ CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
rJMSF038N09+ CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
rJMFF025B12+ CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
rJMFF024K11+ CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGGTCCCTA
rJMFF046A08+ CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
                      ____________________________________________________________
consensus CTTGCCGAATCC-TTTTCTGCTAGGAAACCTGCTGTTATCAATGTCACAATTGATCCCTA
 
. : . : . : . : . : . :
JMFN018H21- TGCTG
rJMFF034E03+ TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
rJMSF014C07+ TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
rJMFF039F21+ TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
rJMFF009M18+ TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
rJMSF038N09+ TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
rJMFF025B12+ TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
rJMFF024K11+ TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
rJMFF046A08+ TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
                      ____________________________________________________________
consensus TGCTGGTGCTGAAAGTGGGAGACTGCAACACAAAAACTGAGGCACAGGGCATTTCAGATC
 
. : . : . : . : . : . :
rJMFF034E03+ CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
rJMSF014C07+ CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
rJMFF039F21+ CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
rJMFF009M18+ CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
rJMSF038N09+ CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
rJMFF025B12+ CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
rJMFF024K11+ CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
rJMFF046A08+ CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
                      ____________________________________________________________
consensus CATTTACACATGGTGGCAGTGTAGTAGGATCAAGTGCTTTTGAAGTGCTGGTGATGCAGC
 
. : . : . : . : . : . :
rJMFF034E03+ ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
rJMSF014C07+ ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
rJMFF039F21+ ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
rJMFF009M18+ ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
rJMSF038N09+ ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
rJMFF025B12+ ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
rJMFF024K11+ ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
rJMFF046A08+ ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
                      ____________________________________________________________
consensus ATCTTTTTGGTCATTTTCTTGGGGCTGGAAGCTTGTCACACCATGTCTAGTGTTTCTAGA
 
. : . : . : . : . : . :
rJMFF034E03+ TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
rJMSF014C07+ TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
rJMFF039F21+ TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
rJMFF009M18+ TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
rJMSF038N09+ TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
rJMFF025B12+ TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
rJMFF024K11+ TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
rJMFF046A08+ TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
                      ____________________________________________________________
consensus TTAATAATGTCAGTATATGTGTATGTGAATGTATCAACATACTTAACTCAAGAGTCTTAT
 
. : . : . : . : . : . :
rJMFF034E03+ CTCAGCCCAGAACCCATCAGCTATACATATATATAATAGAAATATAATTTTGTTGTAGAT
rJMSF014C07+ CTCAGCCCAGAACCCATCAGCTATACATATATATAATAGAAATATAATTTTGTTGTAGAT
rJMFF039F21+ CTCAGCCCAGAACCCATCAGCTATACATATATATAA
rJMFF009M18+ CTCAGCCCAGAACCCATCAGCTATACATATATATAA
rJMSF038N09+ CTCAGCCCAGAACCCATCAGCTATACATATATATAATAGAAATATAATTTTGTTGTAGAT
rJMFF025B12+ CTCAGCCCAGAACCCATCAGCTATACATATATATAATAGAAATATAATTTTGTTGTAGAT
rJMFF024K11+ CTCAGCCCAGAACCCATCAGCTATACATATATATAATAGAAATATAATTTTGTTGTAGAT
rJMFF046A08+ CTCAGCCCAGAACCCATCAGCTATACATATATATAATAGAAATATAATTTTGTTGTAGAT
                      ____________________________________________________________
consensus CTCAGCCCAGAACCCATCAGCTATACATATATATAATAGAAATATAATTTTGTTGTAGAT
 
. : . : . : . : . : . :
rJMFF034E03+ TTTGACCATC
rJMSF014C07+ TTTGACCATCTGTA
rJMSF038N09+ TTTGACCATCTGTATGGAATGTTTTTCTGGTGTCCAAAAATATTCTGC
rJMFF025B12+ TTTGACCATCTGTATGGAATGTTTTTCTGGTGTCCAAAAATATTCTGCTGCAATAAACCC
rJMFF024K11+ TTTGACCATCTGTATGGAATGTTTTTCTGGTGTCCAAAAATATTCTGCTGCAATAAACCC
rJMFF046A08+ TTTGACCATCTGTATGGAATGTTTTTCTGGTGTCCAAAAATATTCTGCTGCAATAAACCC
                      ____________________________________________________________
consensus TTTGACCATCTGTATGGAATGTTTTTCTGGTGTCCAAAAATATTCTGCTGCAATAAACCC
 
. : . : . : . : . : . :
rJMFF025B12+ T
rJMFF024K11+ T
rJMFF046A08+ TGTTTTTATTGAAACATTCTTTAGTTGCATGCGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGTTTTTATTGAAACATTCTTTAGTTGCATGCGAAAAAAAAAAAAAAAACTCTCCAGGGT