Previous Contig 010590:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045O01Sequence386010590 (2)426010590 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045O01- ATTCTT
rJMFF045O01+ ATTCTT
                      ____________________________________________________________
consensus ATTCTT
 
. : . : . : . : . : . :
JMFF045O01- CTTCTTCTTATCGTTAGTTCTCGATTGATCTATCTGTTCATTTCGTGTTTCAGACATGAG
rJMFF045O01+ CTTCTTCTNATCGTTAGTTCTCGATTGATCTATCTGTTCATTTCGTGTTTCAGACATGAG
                      ____________________________________________________________
consensus CTTCTTCTTATCGTTAGTTCTCGATTGATCTATCTGTTCATTTCGTGTTTCAGACATGAG
 
. : . : . : . : . : . :
JMFF045O01- CGCTCCTCCCAACTACGCTTACCCATATCCTCCTCAAGGCTATTACCAGGGACCGCCGGT
rJMFF045O01+ CGCTCCTCCCAACTACGCTTACCCATATCCTCCTCAAGGCTATTACCAGGGACCGCCGGT
                      ____________________________________________________________
consensus CGCTCCTCCCAACTACGCTTACCCATATCCTCCTCAAGGCTATTACCAGGGACCGCCGGT
 
. : . : . : . : . : . :
JMFF045O01- GATGCCGCCACCTCAATACGCCGCTCCGCCGCCGAAGAGAAACCGGGGGTTTCTAGAGGG
rJMFF045O01+ GATGCCGCCACCTCAATACGCCGCTCCGCCGCCGAAGAGAAACCGGGGGTTTCTAGAGGG
                      ____________________________________________________________
consensus GATGCCGCCACCTCAATACGCCGCTCCGCCGCCGAAGAGAAACCGGGGGTTTCTAGAGGG
 
. : . : . : . : . : . :
JMFF045O01- ATTACTTGCAGCTTTGTGTTGCTGTTGCCTCATAGATGAATGCTGTTGTGATCCCTCCAT
rJMFF045O01+ ATTACTTGCAGCTTTGTGTTGCTGTTGCCTCATAGATGAATGCTGTTGTGATCCCTCCAT
                      ____________________________________________________________
consensus ATTACTTGCAGCTTTGTGTTGCTGTTGCCTCATAGATGAATGCTGTTGTGATCCCTCCAT
 
. : . : . : . : . : . :
JMFF045O01- CGTCTTCGTCACCTAAGAATTAACACTAGCTACTATATTTTACTATACATCTTCATGTTA
rJMFF045O01+ CGTCTTCGTCACCTAAGAATTAACACTAGCTACTATATTTTACTATACATCTTCATGTTA
                      ____________________________________________________________
consensus CGTCTTCGTCACCTAAGAATTAACACTAGCTACTATATTTTACTATACATCTTCATGTTA
 
. : . : . : . : . : . :
JMFF045O01- TGTAATACACAGAATTAATATATTTTACTAAGTACATCTGTATTATGTAAAATTTAAATA
rJMFF045O01+ TGTAATACACAGAATTAATATATTTTACTAAGTACATCTGTATTATGTAAAATTTAAATA
                      ____________________________________________________________
consensus TGTAATACACAGAATTAATATATTTTACTAAGTACATCTGTATTATGTAAAATTTAAATA
 
. : . : . : . : . : . :
JMFF045O01- ATTACATTCATCATATT
rJMFF045O01+ ATTACATTCATCATATTATAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ATTACATTCATCATATTATAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG