Previous Contig 010589:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007J21Sequence491010589 (12)pir|D96673|D966732e-39hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894795010589 (12)pir|D96673|D966732e-65hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894
JMFF026F01Sequence492010589 (12)pir|D96673|D966732e-39hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894743010589 (12)pir|D96673|D966737e-56hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894
JMFF045N23Sequence638010589 (12)pir|D96673|D966736e-68hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894484010589 (12)pir|D96673|D966730.022hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894
JMSF018I19Sequence417010589 (12)pir|D96673|D966732e-26hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894775010589 (12)pir|D96673|D966736e-63hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894
JMSF019I19Sequence371010589 (12)pir|D96673|D966732e-18hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894691010589 (12)pir|D96673|D966732e-47hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894
JMSF051F21Sequence670010589 (12)pir|D96673|D966734e-75hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894747010589 (12)pir|D96673|D966732e-74hypothetical protein F13O11.28 [imported] - Arabidopsis thaliana>gb:AE005173_894

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045N23- GTTACGAGCTCCGATTCCCTTGCAGCGTTGTCTATCTCTCGTCTTTGTC
JMFF026F01- GTTACGAGCTCCGATTCCCTTGCAGCGTTGTCTATCTCTCGTCTTTGTC
JMSF018I19- ACGAGCTCCGATTCCCTTGCAGCGTTGTCTATCTCTCGTCTTTGTC
JMSF019I19- ACGAGCTCCGATTCCCTTGCAGCGTTGTCTATCTCTCGTCTTTGTC
JMFF007J21- GTTACGAGCTCCGATTCCCTTGCAGCGTTGTCTATCTCTCGTCTTTGTC
JMSF051F21- GAAGTTACGAGCTCCGATTCCCTTGCAGCGTTGTCTATCTCTCGTCTTTGTC
                      ____________________________________________________________
consensus GAAGTTACGAGCTCCGATTCCCTTGCAGCGTTGTCTATCTCTCGTCTTTGTC
 
. : . : . : . : . : . :
JMFF045N23- TCTCCGTTATCCACTTTCACAAAGGTTTGAGAATCTTGATCTAGAATGTCGTCGGTGGCA
JMFF026F01- TCTCCGTTATCCACTTTCACAAAGGTTTGAGAATCTTGATCTAGAATGTCGTCGGTGGCA
JMSF018I19- TCTCCGTTATCCACTTTCACAAAGGTTTGAGAATCTTGATCTAGAATGTCGTCGGTGGCA
JMSF019I19- TCTCCGTTATCCACTTTCACAAAGGTTTGAGAATCTTGATCTAGAATGTCGTCGGTGGCA
JMFF007J21- TCTCCGTTATCCACTTTCACAAAGGTTTGAGAATCTTGATCTAGAATGTCGTCGGTGGCA
JMSF051F21- TCTCCGTTATCCACTTTCACAAAGGTTTGAGAATCTTGATCTAGAATGTCGTCGGTGGCA
                      ____________________________________________________________
consensus TCTCCGTTATCCACTTTCACAAAGGTTTGAGAATCTTGATCTAGAATGTCGTCGGTGGCA
 
. : . : . : . : . : . :
JMFF045N23- CAAGATTTGCCTGTGAATGGCGTGGAGGTAAAGAAATCTGAGATTACTTCCGTTCCAGTT
JMFF026F01- CAAGATTTGCCTGTGAATGGCGTGGAGGTAAAGAAATCTGAGATTACTTCCGTTCCAGTT
JMSF018I19- CAAGATTTGCCTGTGAATGGCGTGGAGGTAAAGAAATCTGAGATTACTTCCGTTCCAGTT
JMSF019I19- CAAGATTTGCCTGTGAATGGCGTGGAGGTAAAGAAATCTGAGATTACTTCCGTTCCAGTT
JMFF007J21- CAAGATTTGCCTGTGAATGGCGTGGAGGTAAAGAAATCTGAGATTACTTCCGTTCCAGTT
JMSF051F21- CAAGATTTGCCTGTGAATGGCGTGGAGGTAAAGAAATCTGAGATTACTTCCGTTCCAGTT
                      ____________________________________________________________
consensus CAAGATTTGCCTGTGAATGGCGTGGAGGTAAAGAAATCTGAGATTACTTCCGTTCCAGTT
 
. : . : . : . : . : . :
JMFF045N23- TCAATGAATACGAATAGTGGAACTACTAAACCAGAGAATGGAAATGCCTCAAAGCCATTC
JMFF026F01- TCAATGAATACGAATAGTGGAACTACTAAACCAGAGAATGGAAATGCCTCAAAGCCATTC
JMSF018I19- TCAATGAATACGAATAGTGGAACTACTAAACCAGAGAATGGAAATGCCTCAAAGCCATTC
JMSF019I19- TCAATGAATACGAATAGTGGAACTACTAAACCAGAGAATGGAAATGCCTCAAAGCCATTC
JMFF007J21- TCAATGAATACGAATAGTGGAACTACTAAACCAGAGAATGGAAATGCCTCAAAGCCATTC
JMSF051F21- TCAATGAATACGAATAGTGGAACTACTAAACCAGAGAATGGAAATGCCTCAAAGCCATTC
                      ____________________________________________________________
consensus TCAATGAATACGAATAGTGGAACTACTAAACCAGAGAATGGAAATGCCTCAAAGCCATTC
 
. : . : . : . : . : . :
JMFF045N23- AAGATTTTCATAGGCTATGATCCCCGTGAAGATGTTGCTTATGAGGTCTGCCGCCATTCC
JMFF026F01- AAGATTTTCATAGGCTATGATCCCCGTGAAGATGTTGCTTATGAGGTCTGCCGCCATTCC
JMSF018I19- AAGATTTTCATAGGCTATGATCCCCGTGAAGATGTTGCTTATGAGGTCTGCCGCCATTCC
JMSF019I19- AAGATTTTCATAGGCTATGATCCCCGTGAAGATGTTGCTTATGAGGTCTGCCGCCATTCC
JMFF007J21- AAGATTTTCATAGGCTATGATCCCCGTGAAGATGTTGCTTATGAGGTCTGCCGCCATTCC
JMSF051F21- AAGATTTTCATAGGCTATGATCCCCGTGAAGATGTTGCTTATGAGGTCTGCCGCCATTCC
                      ____________________________________________________________
consensus AAGATTTTCATAGGCTATGATCCCCGTGAAGATGTTGCTTATGAGGTCTGCCGCCATTCC
 
. : . : . : . : . : . :
JMFF045N23- CTTTTGAAAAGATCTTCAATCCCCATTGAAATCCACCCCATTAAACAATCTGAATTGAGG
JMFF026F01- CTTTTGAAAAGATCTTCAATCCCCATTGAAATCCACCCCATTAAACAATCTGAATTGAGG
JMSF018I19- CTTTTGAAAAGATCTTCAATCCCCATTGAAATCCACCCCATTAAACAATCTGAATTGAGG
JMSF019I19- CTTTTGAAAAGATCTTCAATCCCCATTGAAATCCACCCCATTAAACAATCTGAATTGAGG
JMFF007J21- CTTTTGAAAAGATCTTCAATCCCCATTGAAATCCACCCCATTAAACAATCTGAATTGAGG
JMSF051F21- CTTTTGAAAAGATCTTCAATCCCCATTGAAATCCACCCCATTAAACAATCTGAATTGAGG
                      ____________________________________________________________
consensus CTTTTGAAAAGATCTTCAATCCCCATTGAAATCCACCCCATTAAACAATCTGAATTGAGG
 
. : . : . : . : . : . :
JMFF045N23- CAGAAGAGCCTTTATTGGCGTGAGAGAGGGAAACTGGAGAGCACTGAGTTTTCCTTTTCG
JMFF026F01- CAGAAGAGCCTTTATTGGCGTGAGAGAGGGAAACTGGAGAGCACTGAGTTTTCCTTTTCG
JMSF018I19- CAGAAGAGCCTTTATTGGCGTGAGAGAGGGAAACTGGAGAGCACTGAGTTTTCCTTTTCG
JMSF019I19- CAGAAGAGCCTTTATTGGCGTGAG
JMFF007J21- CAGAAGAGCCTTTATTGGCGTGAGAGAGGGAAACTGGAGAGCACTGAGTTTTCCTTTTCG
JMSF051F21- CAGAAGAGCCTTTATTGGCGTGAGAGAGGGAAACTGGAGAGCACTGAGTTTTCCTTTTCG
                      ____________________________________________________________
consensus CAGAAGAGCCTTTATTGGCGTGAGAGAGGGAAACTGGAGAGCACTGAGTTTTCCTTTTCG
 
. : . : . : . : . : . :
JMFF045N23- CGGTTCTTGACCCCTTACCTTGCCAATTATGGGGGTTGGGCCATGTTTGTGGATTGTGAT
JMFF026F01- CGGTTCTTGACCCCTTACCTTGCCAATTATGGGGGTTGGGCCATGTTTGTGGATTGTGAT
JMSF018I19- CGGTTCTTGA
JMFF007J21- CGGTTCTTGACCCCTTACCTTGCCAATTATGAGGGTTGGGCCATGTTTGTGGATTGTGAT
JMSF051F21- CGGTTCTTGACCCCTTACCTTGCCAATTATGAGGGTTGGGCCATGTTTGTGGATTGTGAT
rJMSF051F21+ GGGTTGGGCCATGTTTGTGGATTGTGAT
                      ____________________________________________________________
consensus CGGTTCTTGACCCCTTACCTTGCCAATTATGGGGGTTGGGCCATGTTTGTGGATTGTGAT
 
. : . : . : . : . : . :
JMFF045N23- TTCCTCTACCTGGGTGACATTAAGGAATTGAGGGATTTGATTGATGATAAGTATGCTGTA
JMFF026F01- TTCCTCTACCTGGGTGACATT
JMFF007J21- TTCCTCTACCTGGGTGACAT
JMSF051F21- TTCCTCTACCTGGGTGACATTAAGGAATTGAGGGATTTGATTGATGATAAGTATGCTGTA
rJMSF051F21+ TTCCTCTACCTGGGTGACATTAAGGAATTGAGGGATTTGATTGATGATAAGTATGCTGTA
rJMSF018I19+ TGAGGGATTTGATTGATGATAAGTATGCTGTA
rJMFF007J21+ TGACATTAAGGAATTGAGGGATTTGATTGATGATAAGTATGCTGTA
                      ____________________________________________________________
consensus TTCCTCTACCTGGGTGACATTAAGGAATTGAGGGATTTGATTGATGATAAGTATGCTGTA
 
. : . : . : . : . : . :
JMFF045N23- ATGTGTGTACAACATGATTATGCTCCAAAGGAGACCACAAAAATGGATGGGGCAGTGCAA
JMSF051F21- ATGTGTGTACAACATGATTATGCTCCAAAGGAGACCACAAAAATGGATGGGGCAGTGCAA
rJMSF051F21+ ATGTGTGTACAACATGATTATGCTCCAAAGGAGACCACAAAAATGGATGGGGCAGTGCAA
rJMSF018I19+ ATGTGTGTACAACATGATTATGCTCCAAAGGAGACCACAAAAATGGATGGGGCAGTGCAA
rJMFF026F01+ TGTACAACATGATTATGCTCCAAAGGAGACCACAAAAATGGATGGGGCAGTGCAA
rJMSF019I19+ ATGGATGGGGCAGTGCAA
rJMFF007J21+ ATGTGTGTACAACATGATTATGCTCCAAAGGAGACCACAAAAATGGATGGGGCAGTGCAA
                      ____________________________________________________________
consensus ATGTGTGTACAACATGATTATGCTCCAAAGGAGACCACAAAAATGGATGGGGCAGTGCAA
 
. : . : . : . : . : . :
JMFF045N23- ACAGTTTATCCGAGGAAGAACTGGTCATCCATGGTTCTCTACAATTG
JMSF051F21- ACAGTTTATCCGAGGAAGAACTGGTCATCCATGGTTCTCTACAATTGTGGACATCCCAAG
rJMSF051F21+ ACAGTTTATCCGAGGAAGAACTGGTCATCCATGGTTCTCTACAATTGTGGACATCCCAAG
rJMSF018I19+ ACAGTTTATCCGAGGAAGAACTGGTCATCCATGGTTCTCTACAATTGTGGACATCCCAAG
rJMFF026F01+ ACAGTTTATCCGAGGAAGAACTGGTCATCCATGGTTCTCTACAATTGTGGACATCCCAAG
rJMSF019I19+ ACAGTTTATCCGAGGAAGAACTGGTCATCCATGGTTCTCTACAATNGTGGACATCCCAAG
rJMFF007J21+ ACAGTTTATCCGAGGAAGAACTGGTCATCCATGGTTCTCTACAATTGTGGACATCCCAAG
                      ____________________________________________________________
consensus ACAGTTTATCCGAGGAAGAACTGGTCATCCATGGTTCTCTACAATTGTGGACATCCCAAG
 
. : . : . : . : . : . :
JMSF051F21- AATAAGGTGCTAACCCCT
rJMSF051F21+ AATAAGGTGCTAACCCCTGAGGTGGTGAATTCTGAGTCTGGTGCATTTCTTCATAGGTTC
rJMSF018I19+ AATAAGGTGCTAACCCCTGAGGTGGTGAATTCTGAGTCTGGTGCATTTCTTCATAGGTTC
rJMFF026F01+ AATAAGGTGCTAACCCCTGAGGTGGTGAATTCTGAGTCTGGTGCATTTCTTCATAGGTTC
rJMSF019I19+ AATAAGGTGCTAACCCCTGAGGTGGTGAATTCTGAGTCTGGTGCATTTCTTCATAGGTTC
rJMFF007J21+ AATAAGGTGCTAACCCCTGAGGTGGTGAATTCTGAGTCTGGTGCATTTCTTCATAGGTTC
                      ____________________________________________________________
consensus AATAAGGTGCTAACCCCTGAGGTGGTGAATTCTGAGTCTGGTGCATTTCTTCATAGGTTC
 
. : . : . : . : . : . :
rJMSF051F21+ ACGTGGTTAGAAGATCACGAGATCGGAGATGTCCCTTTTGTATGGAATTTCCTTGTAGGG
rJMSF018I19+ ACGTGGTTAGAAGATCACGAGATCGGAGATGTCCCTTTTGTATGGAATTTCCTTGTAGGG
rJMFF026F01+ ACGTGGTTAGAAGATCACGAGATCGGAGATGTCCCTTTTGTATGGAATTTCCTTGTAGGG
rJMSF019I19+ ACGTGGTTAGAAGATCACGAGATCGGAGATGTCCCTTTTGTATGGAATTTCCTTGTAGGG
rJMFF007J21+ ACGTGGTTAGAAGATCACGAGATCGGAGATGTCCCTTTTGTATGGAATTTCCTTGTAGGG
                      ____________________________________________________________
consensus ACGTGGTTAGAAGATCACGAGATCGGAGATGTCCCTTTTGTATGGAATTTCCTTGTAGGG
 
. : . : . : . : . : . :
rJMSF051F21+ CACAATCGGGTTGTTGAGGGCAATCCTTCTACTCTTCCCAAGGCAATCCACTACACCCTT
rJMSF018I19+ CACAATCGGGTTGTTGAGGGCAATCCTTCTACTCTTCCCAAGGCAATCCACTACACCCTT
rJMFF026F01+ CACAATCGGGTTGTTGAGGGCAATCCTTCTACTCTTCCCAAGGCAATCCACTACACCCTT
rJMSF019I19+ CACAATCGGGTNGTTGAGGGCAATCCTTCTACTCTTCCCAAGGCAATCCACTACACCCTT
rJMFF007J21+ CACAATCGGGTTGTTGAGGGCAATCCTTCTACTCTTCCCAAGGCAATCCACTACACCCTT
rJMFF045N23+ CCTT
                      ____________________________________________________________
consensus CACAATCGGGTTGTTGAGGGCAATCCTTCTACTCTTCCCAAGGCAATCCACTACACCCTT
 
. : . : . : . : . : . :
rJMSF051F21+ GGGGGTCCCTGGTTTGAGGCATGGAAGGATTGTGACTTTGCAGACTTGTGGTTGAAGGAG
rJMSF018I19+ GGGGGTCCCTGGTTTGAGGCATGGAAGGATTGTGACTTTGCAGACTTGTGGTTGAAGGAG
rJMFF026F01+ GGGGGTCCCTGGTTTGAGGCATGGAAGGATTGTGACTTTGCAGACTTGTGGTTGAAGGAG
rJMSF019I19+ GGGGGTCCCTGGTTTGAGGCATGGAAGGATTGTGACTTTGCAGACTTGTGGTTGAAGGAG
rJMFF007J21+ GGGGGTCCCTGGTTTGAGGCATGGAAGGATTGTGACTTTGCAGACTTGTGGTTGAAGGAG
rJMFF045N23+ GGGGGTCCCTGGTTTGAGGCATGGAAGGATTGTGACTTTGCAGACTTGTGGTTGAAGGAG
                      ____________________________________________________________
consensus GGGGGTCCCTGGTTTGAGGCATGGAAGGATTGTGACTTTGCAGACTTGTGGTTGAAGGAG
 
. : . : . : . : . : . :
rJMSF051F21+ TTGGAGGAATACAAGAAAACAGAGAAGGTGGATTAGACATTGTTTTGGTTGTGCTCTCTG
rJMSF018I19+ TTGGAGGAATACAAGAAAACAGAGAAGGTGGATTAGACATTGTTTTGGTTGTGCTCTCTG
rJMFF026F01+ TTGGAGGAATACAAGAAAACAGAGAAGGTGGATTAGACATTGTTTTGGTTGTGCTCTCTG
rJMSF019I19+ TTGGAGGAATACAAGAAAACAGAGAAGGTGGATTAGACATTGTTTTGGTTGTGCTCTCTG
rJMFF007J21+ TTGGAGGAATACAAGAAAACAGAGAAGGTGGATTAGACATTGTTTTGGTTGTGCTCTCTG
rJMFF045N23+ TTGGAGGAATCCAAGAAAACAGAGAAGGTGGATTAGACATTGTTTTGGTTGTGCTCTCTG
                      ____________________________________________________________
consensus TTGGAGGAATACAAGAAAACAGAGAAGGTGGATTAGACATTGTTTTGGTTGTGCTCTCTG
 
. : . : . : . : . : . :
rJMSF051F21+ GTTGGCTGGCTAGAGGTAATTCATAAATGGTGGTACTATTTGTGTTGGTGCTTTTTGCTT
rJMSF018I19+ GTTGGCTGGCTAGAGGTAATTCATAAATGGTGGTACTATTTGTGTTGGTGCTTTTTGCTT
rJMFF026F01+ GTTGGCTGGCTAGAGGTAATTCATAAATGGTGGTACTATTTGTGTTGGTGCTTTTTGCTT
rJMSF019I19+ GTTGGCTGGCTAGAGGTAATTCATAAATGGTGGTACTATTTGTGTTGGTGCTTTTTGCTN
rJMFF007J21+ GTTGGCTGGCTAGAGGTAATTCATAAATGGTGGTACTATTTGTGTTGGTGCTTTTTGCTT
rJMFF045N23+ GTTGGCTGGCTAGAGGTAATTCATAAATGGTGGTACTATTTGTGTTGGTGCTTTTTGCTT
                      ____________________________________________________________
consensus GTTGGCTGGCTAGAGGTAATTCATAAATGGTGGTACTATTTGTGTTGGTGCTTTTTGCTT
 
. : . : . : . : . : . :
rJMSF051F21+ TGGTATATTGATGGAGTATTCATTTAGTTTCATTTAGAAATTGTTCAATGTGGGATGCTA
rJMSF018I19+ TGGTATATTGATGGAGTATTCATTTAGTTTCATTTAGAAATTGTTCAATGTGGGATGCTA
rJMFF026F01+ TGGTATATTGATGGAGTATTCATTTAGTTTCATTTAGAAATTGTTCAATGTGGGATGCTA
rJMSF019I19+ TGGTATANTGATGGAGTATTCATTTAGTTTCATTTAGAAATTGTTCAATGTGGGATGCTA
rJMFF007J21+ TGGTATATTGATGGAGTATTCATTTAGTTTCATTTAGAAATTGTTCAATGTGGGATGCTA
rJMFF045N23+ TGGTATATTGATGGAGTATTCATTTAGTTTCATTTAGAAATTGTTCAATGTGGGATGCTA
                      ____________________________________________________________
consensus TGGTATATTGATGGAGTATTCATTTAGTTTCATTTAGAAATTGTTCAATGTGGGATGCTA
 
. : . : . : . : . : . :
rJMSF051F21+ TTCAATTGATTCCAAAATTTGACTCTGTAATCTCATCTCTGGCTATATAGCATACGTTGT
rJMSF018I19+ TTCAATTGATTCCAAAATTTGACTCTGTAATCTCATCTCTGGCTATATAGCATACGTTGT
rJMFF026F01+ TTCAATTGATTCCAAAATTTGACTCTGTAATCTCATCTCTGGCTATATAGCATACGTTGT
rJMSF019I19+ TTCAATTGATTCCAAAATTTGACTCTGTAATCTCATCTCTGGCTATATAGCATACGTTGT
rJMFF007J21+ TTCAATTGATTCCAAAATTTGACTCTGTAATCTCATCTCTGGCTATATAGCATACGTTGT
rJMFF045N23+ TTCAATTGATTCCAAAATTTGACTCTGTAATCTCATCTCTGGCTATATAGCATACGTTGT
                      ____________________________________________________________
consensus TTCAATTGATTCCAAAATTTGACTCTGTAATCTCATCTCTGGCTATATAGCATACGTTGT
 
. : . : . : . : . : . :
rJMSF051F21+ AGTTTTTCACAATTGTCCATGGCTTTGCAGACAAGAGCCATGTTGATGTATTAGTAT
rJMSF018I19+ AGTTTTTCACAATTGTCCATGGCTTTGCAGACAAGAGCCATGTTGATGTATTAGTATTGT
rJMFF026F01+ AGTTTTTCACAATTGTCCATGGCTTTGCAGACAAGAGCCATGTTGATGTATTAGTATTGT
rJMSF019I19+ AGTTTTTCACAATTGTCCATGGCTTTGCAGACAAGAGCCATGCTGATGTATTAGTATTGT
rJMFF007J21+ AGTTTTTCACAATTGTCCATGGCTTTGCAGACAAGAGCCATGTTGATGTATTAGTATTGT
rJMFF045N23+ AGTTTTTCACAATTGTCCATGGCTTTGCAGACAAGAGCCATGTTGATGTATTAGTATTGT
                      ____________________________________________________________
consensus AGTTTTTCACAATTGTCCATGGCTTTGCAGACAAGAGCCATGTTGATGTATTAGTATTGT
 
. : . : . : . : . : . :
rJMSF018I19+ ATTGGTTCCACATAGTAGTCTTCTATGTTGAAGAGGAATTAGATATTGTGGCTAGTTATC
rJMFF026F01+ ATTGGTTCCACATAGTAGTCTTCTATGTTGAAGAGGAATTAGATATTGTGGCTAGTTATC
rJMSF019I19+ ATTGGTTCCACATAGTAGTCTTCTATGTTGAAGAGGAATTAGATATTGTGGCTAGTTATC
rJMFF007J21+ ATTGGTTCCACATAGTAGTCTTCTATGTTGAAGAGGAATTAGATATTGTGGCTAGTTATC
rJMFF045N23+ ATTGGTTCCCCATAGTAGTCTTCTATGTTGAAGAGGAATTAGATATTGTGGCTAGTTATC
                      ____________________________________________________________
consensus ATTGGTTCCACATAGTAGTCTTCTATGTTGAAGAGGAATTAGATATTGTGGCTAGTTATC
 
. : . : . : . : . : . :
rJMSF018I19+ TGGGAATTCTTTT
rJMFF026F01+ TGGGAATTCTTTTATTCTTCATGTCCTA
rJMSF019I19+ TGNGAATTCTTTT
rJMFF007J21+ TGGGAATTCTTTTATTCTTCATGTCCTA
rJMFF045N23+ TGGGAATTCTTTTATTCTTCATGTCCTATTTGAGGCTAATTAACTGTCGCTGGTTATGAT
                      ____________________________________________________________
consensus TGGGAATTCTTTTATTCTTCATGTCCTATTTGAGGCTAATTAACTGTCGCTGGTTATGAT