Previous Contig 010587:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017G04Sequence327010587 (4)gb:BT002231_16358342e-38Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666
JMFF045N18Sequence627004610 (5)gb:BT002231_16358343e-15Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666597010587 (4)gb:BT002231_16358342e-73Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666
JMSF029F20Sequence633004610 (5)gb:BT002231_16358341e-23Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666739010587 (4)gb:BT002231_1635834e-101Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666
JMSF036M03Sequence661004610 (5)gb:BT002231_16358341e-19Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666660010587 (4)gb:BT002231_16358342e-93Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029F20+ GGTTTTCAAGGAGAGNTCATTTG
                      ____________________________________________________________
consensus GGTTTTCAAGGAGAGNTCATTTG
 
. : . : . : . : . : . :
rJMSF036M03+ CTGGCGTTTCCTTTTGCACTAAACTTACAACGGGGGAGAACGC
rJMSF029F20+ CAAGCACCTNAACAANCCTGGCGTTTCCTTTTGCACTAAACTTACAACGGGGGAGAACGC
                      ____________________________________________________________
consensus CAAGCACCTNAACAANCCTGGCGTTTCCTTTTGCACTAAACTTACAACGGGGGAGAACGC
 
. : . : . : . : . : . :
rJMSF036M03+ TATAACTAACACGGTGGACATTTGCCATGCACCAAATGGCTCGGTGAAGGTTATGGCTGC
rJMSF029F20+ TATAACTAACACGGTGGACATTTGCCATGCACCAAATGGCTCGGTGAAGGTTATGGCTGC
                      ____________________________________________________________
consensus TATAACTAACACGGTGGACATTTGCCATGCACCAAATGGCTCGGTGAAGGTTATGGCTGC
 
. : . : . : . : . : . :
rJMSF036M03+ GAATAATGATGCTCAAGTTAGAGTATTTGATGCCAACAACTTCGCCCGTCTTAATTGTTT
rJMSF029F20+ GAATAATGATGCTCAAGTTAGAGTATTTGATGCCAACAACTTCGCCCGTCTTAATTGTTT
                      ____________________________________________________________
consensus GAATAATGATGCTCAAGTTAGAGTATTTGATGCCAACAACTTCGCCCGTCTTAATTGTTT
 
. : . : . : . : . : . :
rJMSF036M03+ CACATTCCCTTGGTCTGTGAATAATATCTCTGCCAGCCCAGACGGTAAAATGCTTACTGT
rJMSF029F20+ CACATTCCCTTGGTCTGTGAATAATATCTCTGCCAGCCCAGACGGTAAAATGCTTACTGT
rJMFF045N18+ ATTCCCTTGGTCTGTGAATAATATCTCTGCCAGCCCAGACGGTAAAATGCTTACTGT
                      ____________________________________________________________
consensus CACATTCCCTTGGTCTGTGAATAATATCTCTGCCAGCCCAGACGGTAAAATGCTTACTGT
 
. : . : . : . : . : . :
rJMSF036M03+ AGTTGGAGACGATCCCGATTGTCTACTTGCTGATGCTGAATCAGGAAAGGTAATTGCCAA
rJMSF029F20+ AGTTGGAGACGATCCCGATTGTCTACTTGCTGATGCTGAATCAGGAAAGGTAATTGCCAA
rJMFF045N18+ AGTTGGAGACGATCCCGATTGTCTACTTGCTGATGCTGAATCAGGAAAGGTAATTGCCAA
                      ____________________________________________________________
consensus AGTTGGAGACGATCCCGATTGTCTACTTGCTGATGCTGAATCAGGAAAGGTAATTGCCAA
 
. : . : . : . : . : . :
rJMSF036M03+ CCTTAAAGGTCACCTAGACTATTCATTTGCTTCGGCCTGGCACCCAAATGGTCAAATTTT
rJMSF029F20+ CCTTAAAGGTCACCTAGACTATTCATTTGCTTCGGCCTGGCACCCAAATGGTCAAATTTT
rJMFF045N18+ CCTTAAAGGTCACCTAGACTATTCATTTGCTTCGGCCTGGCACCCAAATGGTCAAATTTT
                      ____________________________________________________________
consensus CCTTAAAGGTCACCTAGACTATTCATTTGCTTCGGCCTGGCACCCAAATGGTCAAATTTT
 
. : . : . : . : . : . :
rJMSF036M03+ TGCCACCGGGAACCAAGACACCACTTGCAGATTATGGGACGTCAGGAACCTGTCACGATC
rJMSF029F20+ TGCCACCGGGAACCAAGACACCACTTGCAGATTATGGGACGTCAGGAACCTGTCACGATC
rJMFF017G04+ CCACTTGCAGATTATGGGACGTCAGGANCCTGTCACGATC
rJMFF045N18+ TGCCACCGGGAACCAAGACACCACTTGCAGATTATGGGACGTCAGGAACCTGTCACGATC
                      ____________________________________________________________
consensus TGCCACCGGGAACCAAGACACCACTTGCAGATTATGGGACGTCAGGAACCTGTCACGATC
 
. : . : . : . : . : . :
rJMSF036M03+ TTTGGCCATTCTCAATGGAAGAATGGGCGCAATACGTGCAATCCAATTCAGTCCAGACGG
rJMSF029F20+ TTTGGCCATTCTCAATGGAAGAATGGGCGCAATACGTGCAATCCAATTCAGTCCAGACGG
rJMFF017G04+ TTTGGCCATTCTCAATGGAAGAATGGGCGCAATACGTGCAATCCAATTCAGTCCAGACGG
rJMFF045N18+ TTTGGCCATTCTCAATGGAAGAATGGGCGCAATACGTGCAATCCAATTCAGTCCAGACGG
                      ____________________________________________________________
consensus TTTGGCCATTCTCAATGGAAGAATGGGCGCAATACGTGCAATCCAATTCAGTCCAGACGG
 
. : . : . : . : . : . :
rJMSF036M03+ CCGGTTCTTGGGCATGGCTGAACCAGCCGATTTCGTGCACATATTCGACACCCAGTCCGA
rJMSF029F20+ CCGGTTCTTGGGCATGGCTGAACCAGCCGATTTCGTGCACATATTCGACACCCAGTCCGA
rJMFF017G04+ CCGGTTNTTGGGCATGGCTGAACCAGCCGATTTCGTGCACATATTCGACACCCAGTCCGA
rJMFF045N18+ CCGGTTCTTGGGCATGGCTGAACCAGCCGATTTCGTGCACATATTCGACACCCAGTCCGA
                      ____________________________________________________________
consensus CCGGTTCTTGGGCATGGCTGAACCAGCCGATTTCGTGCACATATTCGACACCCAGTCCGA
 
. : . : . : . : . : . :
rJMSF036M03+ CTATGTCACCTGCCAGGAGATCGACTTATTCGGTGAAATCGCCGGGATCTCCTTCAGCCC
rJMSF029F20+ CTATGTCACCTGCCAGGAGATCGACTTATTCGGTGAAATCGCCGGGATCTCCTTCAGCCC
rJMFF017G04+ CTATGTCACCTGCCAGGAGATNGACTTATTCGGTGAAATCGCCGGGATCTCCTTCAGCCC
rJMFF045N18+ CTATGTCACCTGCCAGGAGATCGACTTATTCGGTGAAATCGCCGGGATCTCCTTCAGCCC
                      ____________________________________________________________
consensus CTATGTCACCTGCCAGGAGATCGACTTATTCGGTGAAATCGCCGGGATCTCCTTCAGCCC
 
. : . : . : . : . : . :
rJMSF036M03+ CGACACTGAAGCTCTGTTCATCGGAATTTCAGACAGAACATACGGGAGCTTAATAGAGTT
rJMSF029F20+ CGACACTGAAGCTCTGTTCATCGGAATTTCAGACAGAACATACGGGAGCTTAATAGAGTT
rJMFF017G04+ CGACACTGAAGCTCTGTTCATCGGAATTTCAGACAGAACATACGGGAGCTTAATAGAGTT
rJMFF045N18+ CGACACTGAAGCTCTGTTCATCGGAATTTCAGACAGAACATACGGGAGCTTAATAGAGTT
                      ____________________________________________________________
consensus CGACACTGAAGCTCTGTTCATCGGAATTTCAGACAGAACATACGGGAGCTTAATAGAGTT
 
. : . : . : . : . : . :
rJMSF036M03+ CAAACGCAGAAACTATA
rJMSF029F20+ CAAACGCAGAAACTATAATAATACCTATCTAGACTTCCTCTAATGCCGTGGTCCTT
rJMFF017G04+ CAAACGCAGAAACTATAATAATACCTATCTAGACTTCCT
rJMFF045N18+ CAAACGCAGAAACTATAATAATACCTATCTAGACTTCCTCTAATGCCGTGGTCCTTTCAA
                      ____________________________________________________________
consensus CAAACGCAGAAACTATAATAATACCTATCTAGACTTCCTCTAATGCCGTGGTCCTTTCAA
 
. : . : . : . : . : . :
rJMFF045N18+ CATGTTATCAACGTTGCCATTTTTTTCXXXXXXXXXXXXXXXXXXXXXXCTCTCCAGGGT
                      ____________________________________________________________
consensus CATGTTATCAACGTTGCCATTTTTTTCNNNNNNNNNNNNNNNNNNNNNNCTCTCCAGGGT