Previous Contig 010577:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013H11Sequence557010577 (4)gb:AY532658_16120653e-72Nicotiana tabacum putative pyridoxine biosynthesis protein (Pdx2) mRNA, complete730010577 (4)gb:AY532658_16120656e-73Nicotiana tabacum putative pyridoxine biosynthesis protein (Pdx2) mRNA, complete
JMFF045M10Sequence647010577 (4)gb:AY532658_16120654e-85Nicotiana tabacum putative pyridoxine biosynthesis protein (Pdx2) mRNA, complete657010577 (4)gb:AY532658_16120652e-34Nicotiana tabacum putative pyridoxine biosynthesis protein (Pdx2) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF013H11- GTGAAGGAAAGCACTCTACGTGTTTCTG
                      ____________________________________________________________
consensus GTGAAGGAAAGCACTCTACGTGTTTCTG
 
. : . : . : . : . : . :
JMFF013H11- GTTGTCGTCTTCGCCATAACAGCGCCGTCTCTCTCTACAAAACTTTCACATTCTGTTGGC
JMFF045M10- GCCGTCTCTCTCTAC-AAACTTTCACATTCTGTTGGC
                      ____________________________________________________________
consensus GTTGTCGTCTTCGCCATAACAGCGCCGTCTCTCTCTACAAAACTTTCACATTCTGTTGGC
 
. : . : . : . : . : . :
JMFF013H11- GCGGAGAGGGCAGAGGGAAGAAATGGCAGTTGGGGTGCTAGCTTTACAGGGATCTTTCAA
JMFF045M10- GCGGAGAGGGCAGAGGGAAGAAATGGCAGTTGGGGTGCTAGCTTTACAGGGATCTTTCAA
                      ____________________________________________________________
consensus GCGGAGAGGGCAGAGGGAAGAAATGGCAGTTGGGGTGCTAGCTTTACAGGGATCTTTCAA
 
. : . : . : . : . : . :
JMFF013H11- CGAACACATAGCAGCGCTGAGGAGGCTTGGAGTGAAGGGAATAGAAATAAGGAAGGCAGA
JMFF045M10- CGAACACATAGCAGCGCTGAGGAGGCTTGGAGTGAAGGGAATAGAAATAAGGAAGGCAGA
                      ____________________________________________________________
consensus CGAACACATAGCAGCGCTGAGGAGGCTTGGAGTGAAGGGAATAGAAATAAGGAAGGCAGA
 
. : . : . : . : . : . :
JMFF013H11- GCAGCTGCAGAGTGTCTCCTCCCTCATCATCCCTGGCGGTGAAAGCACCACCATGGCTAA
JMFF045M10- GCAGCTGCAGAGTGTCTCCTCCCTCATCATCCCTGGCGGTGAAAGCACCACCATGGCTAA
                      ____________________________________________________________
consensus GCAGCTGCAGAGTGTCTCCTCCCTCATCATCCCTGGCGGTGAAAGCACCACCATGGCTAA
 
. : . : . : . : . : . :
JMFF013H11- GCTCGCCGAGTTTCACAACCTGTTTCCTGCATTGCGCGAGTTTGTGAAAATGGGAAAGCC
JMFF045M10- GCTCGCCGAGTTTCACAACCTGTTTCCTGCATTGCGCGAGTTTGTGAAAATGGGAAAGCC
rJMFF013H11+ CGAGTTTCACAACCTGTTTCNTGCATTGCGCGAGTTTGTGAAAATGGGAAAGCC
                      ____________________________________________________________
consensus GCTCGCCGAGTTTCACAACCTGTTTCCTGCATTGCGCGAGTTTGTGAAAATGGGAAAGCC
 
. : . : . : . : . : . :
JMFF013H11- AGTATGGGGGACTTGTGCAGGCCTTATTTTCTTGGCAGATAAAGCAGTTGGGCAGAAAAC
JMFF045M10- AGTATGGGGGACTTGTGCAGGCCTTATTTTCTTGGCAGATAAAGCAGTTGGGCAGAAAAC
rJMFF013H11+ AGTATGGGGGACTTGTGCAGGCCTTATTTTCTTGGCAGATAAAGCAGTTGGGCAGAAAAC
                      ____________________________________________________________
consensus AGTATGGGGGACTTGTGCAGGCCTTATTTTCTTGGCAGATAAAGCAGTTGGGCAGAAAAC
 
. : . : . : . : . : . :
JMFF013H11- TGGAGGGCAGGAACTCATTGGTGGCCTCGATTGTACTGTTCATCGAAACTTTTTCGGAAG
JMFF045M10- TGGAGGGCAGGAACTCATTGGTGGCCTCGATTGTACTGTTCATCGAAACTTTTTCGGAAG
rJMFF013H11+ TGGAGGGCAGGAACTCATTGGTGGCCTCGATTGTACTGTTCATCGAAACTTTTTCGGAAG
                      ____________________________________________________________
consensus TGGAGGGCAGGAACTCATTGGTGGCCTCGATTGTACTGTTCATCGAAACTTTTTCGGAAG
 
. : . : . : . : . : . :
JMFF013H11- CCAGATTCAAAGCTTTGAGACCGAGCTCGCTATTCCTGAAGTTGCAGCCAAAGAAGGTGG
JMFF045M10- CCAGATTCAAAGCTTTGAGACCGAGCTCGCTATTCCTGAAGTTGCAGCCAAAGAAGGTGG
rJMFF013H11+ CCAGATTCAAAGCTTTGAGACCGAGCTCGCTATTCCTGAAGTTGCAGCCAAAGAAGGTGG
                      ____________________________________________________________
consensus CCAGATTCAAAGCTTTGAGACCGAGCTCGCTATTCCTGAAGTTGCAGCCAAAGAAGGTGG
 
. : . : . : . : . : . :
JMFF013H11- TCCTCCAACATTCCGTGCTGTTTTTATTCGTGCGCCTGCAATCCTTGAA
JMFF045M10- TCCTCCAACATTCCGTGCTGTTTTTATTCGTGCGCCTGCAATCCTTGAAGTAGGCCCAGA
rJMFF013H11+ TCCTCCAACATTCCGTGCTGTTTTTATTCGTGCGCCTGCAATCCTTGAAGTAGGCCCAGA
                      ____________________________________________________________
consensus TCCTCCAACATTCCGTGCTGTTTTTATTCGTGCGCCTGCAATCCTTGAAGTAGGCCCAGA
 
. : . : . : . : . : . :
JMFF045M10- TGTTGAGATTCTGGCAGATGTTCCAGCCTCATCTGTGATAACTG
rJMFF013H11+ TGTTGAGATTCTGGCAGATGTTCCAGCCTCATCTGTGATAACTGAATCCGCGGAGTCTGA
rJMFF045M10+ GAATCCGCGGAGTCTGA
                      ____________________________________________________________
consensus TGTTGAGATTCTGGCAGATGTTCCAGCCTCATCTGTGATAACTGAATCCGCGGAGTCTGA
 
. : . : . : . : . : . :
rJMFF013H11+ GCAGAAAGTGATCGTTGCTGTAAAACAAGGGAACATGCTAGCTACTGCTTTTCACCCTGA
rJMFF045M10+ GCAGAAAGTGATCGTTGCTGTAAAACAAGGGAACATGCTAGCTACTGCTTTTCACCCTGA
                      ____________________________________________________________
consensus GCAGAAAGTGATCGTTGCTGTAAAACAAGGGAACATGCTAGCTACTGCTTTTCACCCTGA
 
. : . : . : . : . : . :
rJMFF013H11+ ACTGACCGCTGATACACGGTGGCATAGTTACTTTTTGAAAATGGTGCCTGAATTTGGAGG
rJMFF045M10+ ACTTACCGCTGATACACGGTGGCATAGTTACTTTTTGAAAATGGTGCCTGAATTTGGAGG
                      ____________________________________________________________
consensus ACTTACCGCTGATACACGGTGGCATAGTTACTTTTTGAAAATGGTGCCTGAATTTGGAGG
 
. : . : . : . : . : . :
rJMFF013H11+ AACATCAAGTATCATCACAACAACTGGTGAAGGTTCCAGCTTTTATGAACGACCAAAAAT
rJMFF045M10+ AACATCAAGTATCATCACAACAACTGGTGAAGGTTCCAGCTTTTATGAACGACCAAAAAT
                      ____________________________________________________________
consensus AACATCAAGTATCATCACAACAACTGGTGAAGGTTCCAGCTTTTATGAACGACCAAAAAT
 
. : . : . : . : . : . :
rJMFF013H11+ TGATCTTCCTGTTTTTCAATAGAAGCAAAAGAAGAAAAGGAGAATTAATACAATCACATC
rJMFF045M10+ TGATCTTCCTGTTTTTCAATAGAAGCAAAAGAAGAAAAGGAGAATTAATACAATCACATC
                      ____________________________________________________________
consensus TGATCTTCCTGTTTTTCAATAGAAGCAAAAGAAGAAAAGGAGAATTAATACAATCACATC
 
. : . : . : . : . : . :
rJMFF013H11+ ATATGATGAATGATAAGATAAAATAGGTTGTAAAAATGCTCTTTTCTTTATCTATTTATC
rJMFF045M10+ ATATGATGAATGATAAGATAAAATAGGTTGTAAAAATGCTCTTTTCTTTATCTATTTATC
                      ____________________________________________________________
consensus ATATGATGAATGATAAGATAAAATAGGTTGTAAAAATGCTCTTTTCTTTATCTATTTATC
 
. : . : . : . : . : . :
rJMFF013H11+ ATTCAACTCACTTGTTTGCAATCTCGTAATAGTTTTTCTACATTTATTAGTTTTGCAGAT
rJMFF045M10+ ATTCAACTCACTTGTTTGCAATCTCGTAATAGTTTTTCTACATTTATTAGTTTTGCAGAT
                      ____________________________________________________________
consensus ATTCAACTCACTTGTTTGCAATCTCGTAATAGTTTTTCTACATTTATTAGTTTTGCAGAT
 
. : . : . : . : . : . :
rJMFF013H11+ GTTCAAATTGTATCTT
rJMFF045M10+ GTTCAAATTGTATCTTTTGCAAACTGCTTTATTAGAAATTTTAAATTAAATTCCTAATTC
                      ____________________________________________________________
consensus GTTCAAATTGTATCTTTTGCAAACTGCTTTATTAGAAATTTTAAATTAAATTCCTAATTC
 
. : . : . : . : . : . :
rJMFF045M10+ TTATAATGGATACACTCCTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTATAATGGATACACTCCTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG