Previous Contig 010572:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020A10Sequence524001007 (2)gb:AY048286_15617472e-32Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851663010572 (5)gb:AY048286_15617473e-37Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851
JMFF032D01Sequence446001007 (2)gb:AY048286_15617478e-20Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851644010572 (5)gb:AY048286_15617476e-30Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851
JMFF045L17Sequence650015014gb:AY048286_15617471e-49Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851502010572 (5)gb:AY048286_15617477e-10Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851
JMSF002M22Sequence326004447 (4)722010572 (5)gb:AY048286_15617472e-35Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851
JMSF029A01Sequence549004447 (4)gb:AY048286_15617471e-05Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851724010572 (5)gb:AY048286_15617477e-37Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029A01+ TGGTAGATTTGGCCGAATTTTAGATGTTTATGTTCCTAAGGTA
rJMSF002M22+ GTAGANTTGGCCGAATTTTAGATGTTTATGTTCCTAAGGTA
                      ____________________________________________________________
consensus TGGTAGATTTGGCCGAATTTTAGATGTTTATGTTCCTAAGGTA
 
. : . : . : . : . : . :
rJMSF029A01+ AGATTTGCATTTGTAATTCTGCAAATGAAACTTAAGTGTTTTCTTAGTAAAATGTTATTC
rJMSF002M22+ AGATTTGCATTTGTAATTCTGCAAATGAAACTTAAGTGTTTTCTTAGTAAAATGTTATTC
                      ____________________________________________________________
consensus AGATTTGCATTTGTAATTCTGCAAATGAAACTTAAGTGTTTTCTTAGTAAAATGTTATTC
 
. : . : . : . : . : . :
rJMSF029A01+ TTTGTGTCATAGGATCCCAAGAGGACAGGTCATAGAGGATTTGG-TTTTGTTACATTTGC
rJMSF002M22+ TTTGTGTCATAGGATCCCAAGAGGACAGGTCATAGAGGATTTGG-TTTTGTTACATTTGC
rJMFF032D01+ GGATCCCAAGAGGACAGNTCATAGAGGATTTGGTTTTTGTTACATTTGC
rJMFF020A10+ AGGATCCCAAGAGGACAGGTCATAGAGGATTTGG-TTTTGTTACATTTGC
                      ____________________________________________________________
consensus TTTGTGTCATAGGATCCCAAGAGGACAGGTCATAGAGGATTTGG-TTTTGTTACATTTGC
 
. : . : . : . : . : . :
rJMSF029A01+ TGAAGATGGTGTAGCAGACCGTGTTTCTCGAAGGACTCATGAGATTTGTGGACAGCAGGT
rJMSF002M22+ TGAAGATGGTGTAGCAGACCGTGTTTCTCGAAGGACTCATGAGATTTGTGGACAGCAGGT
rJMFF032D01+ TGAAGATGGTGTAGCAGACCGTGTTTCTCGAAGGACTCATGAGATTTGTGGACAGCAGGT
rJMFF020A10+ TGAAGATGGTGTAGCAGACCGTGTTTCTCGAAGGACTCATGAGATTTGTGGACAGCAGGT
                      ____________________________________________________________
consensus TGAAGATGGTGTAGCAGACCGTGTTTCTCGAAGGACTCATGAGATTTGTGGACAGCAGGT
 
. : . : . : . : . : . :
rJMSF029A01+ TGCAATAGATTCTGCCACACCACTTGATGATGCTGGTGGTCCAAGTAATGGTTTCATGAT
rJMSF002M22+ TGCAATAGATTCTGCCACACCACTTGATGATGCTGGTGGTCCAAGTAATGGTTTCATGAT
rJMFF032D01+ TGCAATAGATTCTGCCACACCACTTGATGATGCTGGTGGTCCAAGTAATGGTTTCATGAT
rJMFF020A10+ TGCAATAGATTCTGCCACACCACTTGATGATGCTGGTGGTCCAAGTAATGGTTTCATGAT
rJMFF045L17+ GTCCAAGTAATGGTTTCATGAT
                      ____________________________________________________________
consensus TGCAATAGATTCTGCCACACCACTTGATGATGCTGGTGGTCCAAGTAATGGTTTCATGAT
 
. : . : . : . : . : . :
rJMSF029A01+ AGATAATCACCCAGAACCATACGGGGGTTATGGTGGCCCAATGCGGACCTATGGCAGGAT
rJMSF002M22+ AGATAATCACCCAGAACCATACGGGGGTTATGGTGGCCCAATGCGGACCTATGGCAGGAT
rJMFF032D01+ AGATAATCACCCAGAACCATACGGGGGTTATGGTGGCCCAATGCGGACCTATGGCAGGAT
rJMFF020A10+ AGATAATCACCCAGAACCATACGGGGGTTATGGTGGCCCAATGCGGACCTATGGCAGGAT
rJMFF045L17+ AGATAATCACCCAGAACCATACGGGGGTTATGGTGGCCCAATGCGGACCTATGGCAGGAT
                      ____________________________________________________________
consensus AGATAATCACCCAGAACCATACGGGGGTTATGGTGGCCCAATGCGGACCTATGGCAGGAT
 
. : . : . : . : . : . :
rJMSF029A01+ GTATGGTGGCCTGGGTTTTGATGATTGGGGATATGGCATGAACGGTGGCATGGGTAGTAG
rJMSF002M22+ GTATGGTGGCCTGGGTTTTGATGATTGGGGATATGGCATGAACGGTGGCATGGGTAGTAG
rJMFF032D01+ GTATGGTGGCCTGGGTTTTGATGATTGGGGATATGGCATGAACGGTGGCATGGGTAGTAG
rJMFF020A10+ GTATGGTGGCCTGGGTTTTGATGATTGGGGATATGGCATGAACGGTGGCATGGGTAGTAG
rJMFF045L17+ GTATGGTGGCCTGGGTTTTGATGATTGGGGATATGGCATGAACGGTGGCATGGGTAGTAG
                      ____________________________________________________________
consensus GTATGGTGGCCTGGGTTTTGATGATTGGGGATATGGCATGAACGGTGGCATGGGTAGTAG
 
. : . : . : . : . : . :
rJMSF029A01+ TATGGGGGGAGGGAGACCTTCCCGGGCAGATATGAGGTATAGGCCTTATTAGTAGCAGTC
rJMSF002M22+ TATGGGGGGAGGGAGACCTTCCCGGGCAGATATGAGGTATAGGCCTTATTAGTAGCAGTC
rJMFF032D01+ TATGGGGGGAGGGAGACCTTCCCGGGCAGATATGAGGTATAGGCCTTATTAGTAGCAGTC
rJMFF020A10+ TATGGGGGGAGGGAGACCTTCCCGGGCAGATATGAGGTATAGGCCTTATTAGTAGCAGTC
rJMFF045L17+ TATGGGGGGAGGGAGACCTTCCCGGGCAGATATGAGGTATAGGCCTTATTAGTAGCAGTC
                      ____________________________________________________________
consensus TATGGGGGGAGGGAGACCTTCCCGGGCAGATATGAGGTATAGGCCTTATTAGTAGCAGTC
 
. : . : . : . : . : . :
rJMSF029A01+ CCATCTTGATCTGAGTTACAAGCCTTTCTGATAGCAGTCTTGAGCATAAAGGATGTGTGC
rJMSF002M22+ CCATCTTGATCTGAGTTACAAGCCTTTCTGATAGCAGTCTTGAGCATAAAGGATGTGTGC
rJMFF032D01+ CCATCTTGATCTGAGTTACAAGCCTTTCTGATAGCAGTCTTGAGCATAAAGGATGTGTGC
rJMFF020A10+ CCATCTTGATCTGAGTTACAAGCCTTTCTGATAGCAGTCTTGAGCATAAAGGATGTGTGC
rJMFF045L17+ CCATCTTGATTTGAGTTACAAGCCTTTTTGATAGCAGTCTTGAGCATAAAGGATGTGTGC
                      ____________________________________________________________
consensus CCATCTTGATCTGAGTTACAAGCCTTTCTGATAGCAGTCTTGAGCATAAAGGATGTGTGC
 
. : . : . : . : . : . :
rJMSF029A01+ CCCTTGCTAAAAGCAGTTACGAAAAATCGTATCATTGGCCAAGCCTGGAGTTATAACGCA
rJMSF002M22+ CCCTTGCTAAAAGCAGTTACGAAAAATCGTATCATTGGCCAAGCCTGGAGTTATAACGCA
rJMFF032D01+ CCCTTGCTAAAAGCAGTTACGAAAAATCGTATCATTGGCCAAGCCTGGAGTTATAACGCA
rJMFF020A10+ CCCTTGCTAAAAGCAGTTACGAAAAATCGTATCATTGGCCAAGCCTGGAGTTATAACGCA
rJMFF045L17+ CCCTTGCTAAAAGCAGTTACGAAAAATCGTATCATTGGCCAAGCCTGGAGTTATAACGCA
                      ____________________________________________________________
consensus CCCTTGCTAAAAGCAGTTACGAAAAATCGTATCATTGGCCAAGCCTGGAGTTATAACGCA
 
. : . : . : . : . : . :
rJMSF029A01+ ACATGCAGCCACTTGTTGCCATTATATCTTTGAACCATTGATTATGGTGTAACTGGAATA
rJMSF002M22+ ACATGCAGCCACTTGTTGCCATTATATCTTTGAACCATTGATTATGGTGTAACTGGAATA
rJMFF032D01+ ACATGCAGCCACTTGTTGCCATTATATCTTTGAACCATTGATTATGGTGTAACTGGAATA
rJMFF020A10+ ACATGCAGCCACTTGTTGCCATTATATCTTTGAACCATTGATTATGGTGTAACTGGAATA
rJMFF045L17+ ACATGCAGCCACTTGTTGCCATTATATCTTTGAACCATTGATTATGGTGTAACTGGAATA
                      ____________________________________________________________
consensus ACATGCAGCCACTTGTTGCCATTATATCTTTGAACCATTGATTATGGTGTAACTGGAATA
 
. : . : . : . : . : . :
rJMSF029A01+ GTTATGTTATATTTTACTTTCATAAGTTTAGAAAGCTTTTGCAGGGGCCAGAAAGGATGC
rJMSF002M22+ GTTATGTTATATTTTACTTTCATAAGTTTAGAAAGCTTTTGCAGGGGCCAGAAAGGATGC
rJMFF032D01+ GTTATGTTATATTTTACTTTCATAAGTTTAGAAAGCTTTTGCAGGGGCCAGAAAGGATGC
rJMFF020A10+ GTTATGTTATATTTTACTTTCATAAGTTTAGAAAGCTTTTGCAGGGGCCAGAAAGGATGC
rJMFF045L17+ GTTATGTTATATTTTACTTTCATAAGTTTAGAAAGCTTTTGCAGGGGCCAGAAAGGATGC
                      ____________________________________________________________
consensus GTTATGTTATATTTTACTTTCATAAGTTTAGAAAGCTTTTGCAGGGGCCAGAAAGGATGC
 
. : . : . : . : . : . :
rJMSF029A01+ CCCACTGTAATGTACAAT
rJMSF002M22+ CCCACTGTAATGTACAAT
rJMFF032D01+ CCCACTGTAATGTACAATTGAATTCACAATTTTCTAATGCCATTGTTGAACTTAT
rJMFF020A10+ CCCACTGTAATGTACAATTGAATTCACAATTTTCTAATGCCATTGTTGAACTTAT
rJMFF045L17+ CCCCCTGTAATGTACAATTGAATTCACAATTTTTTAATGCCATTGTTGAACTTATTGCTT
                      ____________________________________________________________
consensus CCCACTGTAATGTACAATTGAATTCACAATTTTCTAATGCCATTGTTGAACTTATTGCTT