Previous Contig 010570:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013G15Sequence554000708 (3)sp|P51850|DCP1_PEA8e-70Pyruvate decarboxylase isozyme 1 (EC 4.1.1.1) (PDC).>pir|S65470|S65470 pyruvate 724010570 (3)gb:AC121364_17401642e-65Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052E20, complet
JMFF045K22Sequence654000708 (3)gb:AJ717413_18137974e-86Lotus corniculatus var. japonicus mRNA for pyruvate decarboxylase isozyme 1 (pdc654010570 (3)gb:AC121364_17401642e-42Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052E20, complet
JMFS070H09Sequence627010570 (3)sp|P51850|DCP1_PEA6e-86Pyruvate decarboxylase isozyme 1 (EC 4.1.1.1) (PDC).>pir|S65470|S65470 pyruvate

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS070H09- GACACTGCA
                      ____________________________________________________________
consensus GACACTGCA
 
. : . : . : . : . : . :
JMFS070H09- GTGATTGCAGAGACGGGAGACTCGTGGTTCAACTGCCAAAAGCTCCGTCTCCCTGAGAAT
                      ____________________________________________________________
consensus GTGATTGCAGAGACGGGAGACTCGTGGTTCAACTGCCAAAAGCTCCGTCTCCCTGAGAAT
 
. : . : . : . : . : . :
JMFS070H09- TGCGGGTATGAATTCCAGATGCAGTTTGGATCAATTGGATGGTCTGTGGGTGCAACTCTT
rJMFF013G15+ CGGGTATGAATTCCAGATGCAGTTTGGATCAATTGGATGGTCTGTGGGTGCAACTCTT
                      ____________________________________________________________
consensus TGCGGGTATGAATTCCAGATGCAGTTTGGATCAATTGGATGGTCTGTGGGTGCAACTCTT
 
. : . : . : . : . : . :
JMFS070H09- GGCTATGCTCAGGCTGCAAAGCAGAAGCGCGTTATTGCCTGCATTGGAGATGGAAGTTTC
rJMFF013G15+ GGCTATGCTCAGGCTGCAAAGCAGAAGCGCGTTATTGCCTGCATTGGAGATGGAAGTTTC
                      ____________________________________________________________
consensus GGCTATGCTCAGGCTGCAAAGCAGAAGCGCGTTATTGCCTGCATTGGAGATGGAAGTTTC
 
. : . : . : . : . : . :
JMFS070H09- CAGGTGACAGCTCAAGATATATCAACCATGATGCGGTGTGGACAACGAAGTATCATATTT
rJMFF013G15+ CAGGTGACAGCTCAAGATATATCAACCATGATGCGGTGTGGACAACGAAGTATCATATTT
rJMFF045K22+ ACAGCTCAAGATATATCAACCATGATGCGGTGTGGACAACGAAGTATCATATTT
                      ____________________________________________________________
consensus CAGGTGACAGCTCAAGATATATCAACCATGATGCGGTGTGGACAACGAAGTATCATATTT
 
. : . : . : . : . : . :
JMFS070H09- CTCATCAACAATGGAGGCTACACAATTGAAGTGGAAATTCATGACGGTCCATATAACGTG
rJMFF013G15+ CTCATCAACAATGGAGGCTACACAATTGAAGTGGAAATTCATGACGGTCCATATAACGTG
rJMFF045K22+ CTCATCAACAATGGAGGCTACACAATTGAAGTGGAAATTCATGACGGTCCATATAACGTG
                      ____________________________________________________________
consensus CTCATCAACAATGGAGGCTACACAATTGAAGTGGAAATTCATGACGGTCCATATAACGTG
 
. : . : . : . : . : . :
JMFS070H09- ATCAAGAATTGGGACTACACCGGTCTTGTCAACGCTGTCCACAATGGACAGGGCAAATGT
rJMFF013G15+ ATCAAGAATTGGGACTACACCGGTCTTGTCAACGCTGTCCACAATGGACAGGGCAAATGT
rJMFF045K22+ ATCAAGAATTGGGACTACACCGGTCTTGTCAACGCTGTCCACAATGGACAGGGCAAATGT
                      ____________________________________________________________
consensus ATCAAGAATTGGGACTACACCGGTCTTGTCAACGCTGTCCACAATGGACAGGGCAAATGT
 
. : . : . : . : . : . :
JMFS070H09- TGGACC-AAAAAAGTAAAAACAGAGGAAGAATTAATAGAAGCAATTGCGACCGCGACGAG
rJMFF013G15+ TGGACCAAAAAAAGTAAAAACAGAGGAAGAATTAATAGAAGCAATTGCGACCGCGACGAG
rJMFF045K22+ TGGACCAAAAAAAGTAAAAACAGAGGAAGAATTAATAGAAGCAATTGCGACCGCGACGAG
                      ____________________________________________________________
consensus TGGACCAAAAAAAGTAAAAACAGAGGAAGAATTAATAGAAGCAATTGCGACCGCGACGAG
 
. : . : . : . : . : . :
JMFS070H09- TACACACAAGGACTCGTTATGCTTCATTGAAGTTATTGTGCACAAGGATGACACAAGCAA
rJMFF013G15+ TACACACAAGGACTCGTTATGCTTCATTGAAGTTATTGTGCACAAGGATGACACAAGCAA
rJMFF045K22+ TACACACAAGGACTCGTTATGCTTCATTGAAGTTATTGTGCACAAGGATGACACAAGCAA
                      ____________________________________________________________
consensus TACACACAAGGACTCGTTATGCTTCATTGAAGTTATTGTGCACAAGGATGACACAAGCAA
 
. : . : . : . : . : . :
JMFS070H09- AGAGCTATTGGAATGGGGTTCCCGCGTTTCTTCTGCTAATAGTCGCCCCCCTAATCCTCA
rJMFF013G15+ AGAGCTATTGGAATGGGGTTCCCGCGTTTCTTCTGCTAATAGTCGCCCCCCTAATCCTCA
rJMFF045K22+ AGAGCTATTGGAATGGGGTTCCCGCGTTTCTTCTGCTAATAGTCGCCCCCCTAATCCTCA
                      ____________________________________________________________
consensus AGAGCTATTGGAATGGGGTTCCCGCGTTTCTTCTGCTAATAGTCGCCCCCCTAATCCTCA
 
. : . : . : . : . : . :
JMFS070H09- ATAGCAACCCCAAGATGATGAAAATGTACAGTCCGACCAAACAGTTGGAGTTGATGATCC
rJMFF013G15+ ATAGCAACCCCAAGATGATGAAAATGTACAGTCCGACCAAACAGTTGGAGTTGATGATCC
rJMFF045K22+ ATAGCAACCCCAAGATGATGAAAATGTACAGTCCGACCAAACAGTTGGAGTTGATGATCC
                      ____________________________________________________________
consensus ATAGCAACCCCAAGATGATGAAAATGTACAGTCCGACCAAACAGTTGGAGTTGATGATCC
 
. : . : . : . : . : . :
JMFS070H09- ATCCACACATTCGGACCGT
rJMFF013G15+ ATCCACACATTCGGACCGTAGAAATAATAACAATAATAATGTTAATTTTACCTTTGCCAT
rJMFF045K22+ ATCCACACATTCGGACCGTAGAAATAATAACAATAATAATGTTAATTTTACCTTTGCCAT
                      ____________________________________________________________
consensus ATCCACACATTCGGACCGTAGAAATAATAACAATAATAATGTTAATTTTACCTTTGCCAT
 
. : . : . : . : . : . :
rJMFF013G15+ TGTTGTTGTGCTGTTCTCTTGTTTCCTGACCAGGAAGTTCAGCTTCCGAAAAATGTAATA
rJMFF045K22+ TGTTGTTGTGCTGTTCTCTTGTTTCCTGACCAGGAAGTTCAGCTTCCGAAAAATGTAATA
                      ____________________________________________________________
consensus TGTTGTTGTGCTGTTCTCTTGTTTCCTGACCAGGAAGTTCAGCTTCCGAAAAATGTAATA
 
. : . : . : . : . : . :
rJMFF013G15+ CTACATCCGCTCATTTTTTTAGTACTATTTTAGTGGTCTATTATA-TTGAATAAAATTT
rJMFF045K22+ CTACATCCGCTCATTTTTTTAGTACTATTTTAGTGGTCTATTATATTTGAATAAAATTTT
                      ____________________________________________________________
consensus CTACATCCGCTCATTTTTTTAGTACTATTTTAGTGGTCTATTATATTTGAATAAAATTTT
 
. : . : . : . : . : . :
rJMFF045K22+ AATGAAAATTTAATTTTCGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AATGAAAATTTAATTTTCGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG