Previous Contig 010568:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044P06Sequence637007051 (15)gb:NBE504729_16881664e-55Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp615010568 (7)gb:NBE504730_16881672e-06Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMFF045K18Sequence642007051 (15)gb:NBE504729_16881664e-55Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp629010568 (7)
JMSF010K20Sequence241005173 (2)761010568 (7)gb:NBE504730_16881672e-07Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMSF035O12Sequence665007051 (15)gb:NBE504729_16881662e-59Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp669010568 (7)gb:NBE504730_16881677e-06Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMSF039J16Sequence656007051 (15)gb:NBE504729_16881661e-57Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp877010568 (7)gb:NBE504730_16881671e-59Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMSF040A12Sequence659007051 (15)gb:NBE504729_16881663e-58Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp860010568 (7)gb:NBE504730_16881671e-16Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMSF040A17Sequence656007051 (15)gb:NBE504729_16881661e-57Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp865010568 (7)gb:NBE504730_16881671e-35Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039J16+ GGCCCATGGTGAAACAACCGAAG
                      ____________________________________________________________
consensus GGCCCATGGTGAAACAACCGAAG
 
. : . : . : . : . : . :
rJMSF039J16+ CCTAGGGCCAAGGATCCAAATAAGAGAGAAATGAGTATCGAGGAAAAGCATAAACTTGGA
                      ____________________________________________________________
consensus CCTAGGGCCAAGGATCCAAATAAGAGAGAAATGAGTATCGAGGAAAAGCATAAACTTGGA
 
. : . : . : . : . : . :
rJMSF040A17+ CTGGTGCAGATTATNAGGAAG
rJMSF039J16+ CTTGGATTGCAGAGTTTGCCTCAAGAGAAGATGCCCCAACTGGTGCAGATTATAAGGAAG
                      ____________________________________________________________
consensus CTTGGATTGCAGAGTTTGCCTCAAGAGAAGATGCCCCAACTGGTGCAGATTATAAGGAAG
 
. : . : . : . : . : . :
rJMSF040A17+ AGGAACGAGCATTTGGCACAAGATGGTGATGAAATTGAGCTGGACATTGAGGCTTTGGAC
rJMSF039J16+ AGGAACGAGCATTTGGCACAAGATGGTGATGAAATTGAGCTGGACATTGAGGCTTTGGAC
rJMSF040A12+ AAATTGAGCTGGACATTGAGGCTTTGGAC
                      ____________________________________________________________
consensus AGGAACGAGCATTTGGCACAAGATGGTGATGAAATTGAGCTGGACATTGAGGCTTTGGAC
 
. : . : . : . : . : . :
rJMSF040A17+ ACTGAGACTCTTTGGGAGCTTGATCGATTCGTGA-CCAATTGGAAGAAGATGGTGAGCAA
rJMSF039J16+ ACTGAGACTCTTTGGGAGCTTGATCGATTCGTGA-CCAATTGGAAGAAGATGGTGAGCAA
rJMSF040A12+ ACTGAGACTCTTTGGGAGCTTGATCGATTCGTGACCCAATTGGAAGAAGATGGTGAGCAA
                      ____________________________________________________________
consensus ACTGAGACTCTTTGGGAGCTTGATCGATTCGTGA-CCAATTGGAAGAAGATGGTGAGCAA
 
. : . : . : . : . : . :
rJMSF040A17+ AA-CCAAGAGACAAGCTTTAATAAGTAATTTAACAGCGCCAACTGCTGCTGCAGCTGCAG
rJMSF039J16+ AA-CCAAGAGACAAGCTTTAATAAGTAATTTAACAGCGCCAACTGCTGCTGCAGCTGCAG
rJMSF040A12+ AACCCAAGAGACAAGCTTTAATAAGTAATTTAACAGCGCCAACTGCTGCTGCAGCTGCAG
rJMSF010K20+ AGAGACAAGCTTTAATAAGTAATTTAACAGCGCCAACTGCTGCTGCAGCTGCAG
                      ____________________________________________________________
consensus AA-CCAAGAGACAAGCTTTAATAAGTAATTTAACAGCGCCAACTGCTGCTGCAGCTGCAG
 
. : . : . : . : . : . :
rJMSF040A17+ CTGCTACGACATCCAACGCCGAGAAGTATGATGGGGCTGCTCTAAGCGAGAAAATGGATA
rJMSF039J16+ CTGCTACGACATCCAACGCCGAGGAGGATGATGGGGCTGCTCTAAGCGAGAAAATGGATA
rJMSF040A12+ CTGCTACGACATCCAACGCCGAGGAGGATGATGGGGCTGCTCTAAGCGAGAAAATGGATA
rJMFF044P06+ GAGAAAATGGATA
rJMSF010K20+ CTGCTACGACATCCAACGCCGAGGAGGATGATGGGGCTGCTCTAAGCGAGAAAATGGATA
rJMSF035O12+ AAAATGGATA
                      ____________________________________________________________
consensus CTGCTACGACATCCAACGCCGAGGAGGATGATGGGGCTGCTCTAAGCGAGAAAATGGATA
 
. : . : . : . : . : . :
rJMSF040A17+ TGGATT-CCCCCAAGAAGCCTAAAAAGGGTGAAGCTGGGGATGAGGATGTTGACATTGAT
rJMSF039J16+ TGGATT-CCCCCAAGAAGCCTAAAAAGGGTGAAGCTGGGGATGAGGATGTTGACATTGAT
rJMSF040A12+ TGGATT-CCCCCAAGAAGCCTAAAAAGGGTGAAGCTGGGGATGAGGATGTTGACATTGAT
rJMFF044P06+ TGGATT-CCCCCAAGAAG-CTAAAAAGGGTGAAGCTGGGGATGAGGATGTTGACATTGAT
rJMSF010K20+ TGGATT-CCCCCAAGAAGCCTAAAAAGGGTGAAGCTGGGGATGAGGATGTTGACATTGAT
rJMSF035O12+ TGGATTCCCCCCAAGAAGCCTAAAAAGGGTGAAGCTGGGGATGAGGATGTTGACATTGAT
                      ____________________________________________________________
consensus TGGATT-CCCCCAAGAAGCCTAAAAAGGGTGAAGCTGGGGATGAGGATGTTGACATTGAT
 
. : . : . : . : . : . :
rJMSF040A17+ GATGATATGCCTGCTACCAGTTTTCCTCCTATTGAAATTGAGAAGGACGAAGGTGGTGGT
rJMSF039J16+ GATGATATGCCTGCTACCAGTTTTCCTCCTATTGAAATTGAGAAGGACGAAGGTGGTGGT
rJMSF040A12+ GATGATATGCCTGCTACCAGTTTTCCTCCTATTGAAATTGAGAAGGACGAAGGTGGTGGT
rJMFF044P06+ GATGATATGCCTGCTACCAGTTTTCCTCCTATTGAAATTGAGAAGGACGAAGGTGGTGGT
rJMSF010K20+ GATGATATGCCTGCTACCAGTTTTCCTCCTATTGAAATTGAGAAGGACGAAGGTGGTGGT
rJMSF035O12+ GATGATATGCCTGCTACCAGTTTTCCTCCTATTGAAATTGAGAAGGACGAAGGTGGTGGT
rJMFF045K18+ TATTGAAATTGAGAAGGACGAAGGTGGTGGT
                      ____________________________________________________________
consensus GATGATATGCCTGCTACCAGTTTTCCTCCTATTGAAATTGAGAAGGACGAAGGTGGTGGT
 
. : . : . : . : . : . :
rJMSF040A17+ CGAGATCCTGATAATAATGGCAGTAGTAGCTCTAGCAGTTCAAGTAGTTCAAGCAGTGAT
rJMSF039J16+ CGAGATCCTGATAATAATGGCAGTAGTAGCTCTAGCAGTTCAAGTAGTTCAAGCAGTGAT
rJMSF040A12+ CGAGATCCTGATAATAATGGCAGTAGTAGCTCTAGCAGTTCAAGTAGTTCAAGCAGTGAT
rJMFF044P06+ CGAGATCCTGATAATAATGGCAGTAGTAGCTCTAGCAGTTCAAGTAGTTCAAGCAGTGAT
rJMSF010K20+ CGAGATCCTGATAATAATGGCAGTAGTAGCTCTAGCAGTTCAAGTAGTTCAAGCAGTGAT
rJMSF035O12+ CGAGATCCTGATAATAATGGCAGTAGTAGCTCTAGCAGTTCAAGTAGTTCAAGCAGTGAT
rJMFF045K18+ CGAGATCCTGATAATAATGGCAGTAGTAGCTCTAGCAGTTCAAGTAGTTCAAGCAGTGAT
                      ____________________________________________________________
consensus CGAGATCCTGATAATAATGGCAGTAGTAGCTCTAGCAGTTCAAGTAGTTCAAGCAGTGAT
 
. : . : . : . : . : . :
rJMSF040A17+ TCGTCTTCTTCAAGTGGCTCTGATTCGGGGAGTTCTTCCGGGAGTGACTCAGATGCGGAT
rJMSF039J16+ TCGTCTTCTTCAAGTGGCTCTGATTCGGGGAGTTCTTCCGGGAGTGACTCAGATGCGGAT
rJMSF040A12+ TCGTCTTCTTCAAGTGGCTCTGATTCGGGGAGTTCTTCCGGGAGTGACTCAGATGCGGAT
rJMFF044P06+ TCGTCTTCTTCAAGTGGCTCTGATTCGGGGAGTTCTTCCGGGAGTGACTCAGATGCGGAT
rJMSF010K20+ TCGTCTTCTTCAAGTGGCTCTGATTCGGGGAGTTCTTCCGGGAGTGACTCAGATGCGGAT
rJMSF035O12+ TCGTCTTCTTCAAGTGGCTCTGATTCGGGGAGTTCTTCCGGGAGTGACTCAGATGCGGAT
rJMFF045K18+ TCGTCTTCTTCAAGTGGCTCTGATTCGGGGAGTTCTTCCGGGAGTGACTCAGATGCGGAT
                      ____________________________________________________________
consensus TCGTCTTCTTCAAGTGGCTCTGATTCGGGGAGTTCTTCCGGGAGTGACTCAGATGCGGAT
 
. : . : . : . : . : . :
rJMSF040A17+ GATGCACAATCTTGATTCTACCATGCCCAAGTTGAAGAGGCTCGAGAATCATCAGCTCGA
rJMSF039J16+ GATGCACAATCTTGATTCTACCATGCCCAAGTTGAAGAGGCTCGAGAATCATCAGCTCGA
rJMSF040A12+ GATGCACAATCTTGATTCTACCATGCCCAAGTTGAAGAGGCTCGAGAATCATCAGCTCGA
rJMFF044P06+ GATGCACAATCTTGATTCTACCATGCCCAAGTTGAAGAGGCTCGAGAATCATCAGCTCGA
rJMSF010K20+ GATGCACAATCTTGATTCTACCATGCCCAAGTTGAAGAGGCTCGAGAATCATCAGCTCGA
rJMSF035O12+ GATGCACAATCTTGATTCTACCATGCCCAAGTTGAAGAGGCTCGAGAATCATCAGCTCGA
rJMFF045K18+ GATGCACAATCTTGATTCTACCATGCCCAAGTTGAAGAGGCTCGAGAATCATCAGCTCGA
                      ____________________________________________________________
consensus GATGCACAATCTTGATTCTACCATGCCCAAGTTGAAGAGGCTCGAGAATCATCAGCTCGA
 
. : . : . : . : . : . :
rJMSF040A17+ GCTGTGGCACTCACCTTTTGTCGGTCTTTGTTACCTATGCTATTGTTTGTAATGAGGT
rJMSF039J16+ GCTGTGGGACTCACCTTTTGTCGGTCTTTGTTACCTATGCTATTGTTTGTAATGAGGTGT
rJMSF040A12+ GCTGTGGCACTCACCTTTTGTCGGTCTTTGTTACCTATGCTATTGTTTGTAATGAGGTGT
rJMFF044P06+ GCTGTGGCACTCACCTTTTGTCGGTCTTTGTTACCTATGCTATTGTTTGTAATGAGGTGT
rJMSF010K20+ GCTGTGGCACTCACCTTTTGTCGGTCTTTGTTACCTATGCTATTGTTTGTAATGAGGTGT
rJMSF035O12+ GCTGTGGCACTCACCTTTTGTCGGTCTTTGTTACCTATGCTATTGTTTGTAATGAGGTGT
rJMFF045K18+ GCTGTGGCACTCACCTTTTGTCGGTCTTTGTTACCTATGCTATTGTTTGTAATGAGGTGT
                      ____________________________________________________________
consensus GCTGTGGCACTCACCTTTTGTCGGTCTTTGTTACCTATGCTATTGTTTGTAATGAGGTGT
 
. : . : . : . : . : . :
rJMSF039J16+ AGTGCCCAGCTTGTGGAGGAAAGAAGATAGATGCGTACTATGTATTGGCATTTGAGGTTG
rJMSF040A12+ AGTGCCCAGCTTGTGGAGGAAAGAAGATAGATGCATACTATGTATTGGCATTTGAGGTTG
rJMFF044P06+ AGTGCCCAGCTTGTGGAGGAAAGAAGATAGATGCATACTATGTATTGGCATTTGAGGTTG
rJMSF010K20+ AGTGCCCAGCTTGTGGAGGAAAGAAGATAGATGCATACTATGTATTGGCATTTGAGGTTG
rJMSF035O12+ AGTGCCCAGCTTGTGGAGGAAAGAAGATAGATGCATACTATGTATTGGCATTTGAGGTTG
rJMFF045K18+ AGTGCCCAGCTTGTGGAGGAAAGAAGATAGATGCATACTATGTATTGGCATTTGAGGTTG
                      ____________________________________________________________
consensus AGTGCCCAGCTTGTGGAGGAAAGAAGATAGATGCATACTATGTATTGGCATTTGAGGTTG
 
. : . : . : . : . : . :
rJMSF039J16+ CTTTTAGTTATGGCTCTTTAATGATTAATGATAGGGAAAATGAGAGAGATGTAGATGGTT
rJMSF040A12+ CTTTTAGTTATGGCTCTTTAATGATTAATGATAGGGAAAATGAGAGAGATGTAGATGGTT
rJMFF044P06+ CTTTTAGTTATGGCTCTTTAATGATTAATGATAGGGAAAATGAGAGAGATGTAGATGGTT
rJMSF010K20+ CTTTTAGTTATGGCTCTTTAATGATTAATGATAGGGAAAATGAGAGAGATGTAGATGGTT
rJMSF035O12+ CTTTTAGTTATGGCTCTTTAATGATTAATGATAGGGAAAATGAGAGAGATGTAGATGGTT
rJMFF045K18+ CTTTTAGTTATGGCTCTTTAATGATTAATGATAGGGAAAATGAGAGAGATGTAGATGGTT
                      ____________________________________________________________
consensus CTTTTAGTTATGGCTCTTTAATGATTAATGATAGGGAAAATGAGAGAGATGTAGATGGTT
 
. : . : . : . : . : . :
rJMSF039J16+ GAGACTTCAGATACCCT
rJMSF040A12+ GAGACTTCAGATACCCTCTGTACAGTTGTAATACATGTTGATCATTGTCTTCTGCAATTC
rJMFF044P06+ GAGACTTCAGATACCCTCTGTACAGTTGTAATACATGTTGATCATTGTCTTCTGCAATTC
rJMSF010K20+ GAGACTTCAGATACCCTCTGTACAGTTGTAATACATGTTGATCATTGTCTTCTGCAATTC
rJMSF035O12+ GAGACTTCAGATACCCTCTGTACAGTTGTAATACATGTTGATCATTGTCTTCTGCAATTC
rJMFF045K18+ GAGACTTCAGATACCCTCTGTACAGTTGTAATACATGTTGATCATTGTCTTCTGCAATTC
                      ____________________________________________________________
consensus GAGACTTCAGATACCCTCTGTACAGTTGTAATACATGTTGATCATTGTCTTCTGCAATTC
 
. : . : . : . : . : . :
rJMSF040A12+ CCATTCTTTCATACCTTCCTTTGTCCAGTGTTAGTGTTTGGAATTTGTTTTATATTCTGG
rJMFF044P06+ CCATTCTTTCATACCTTCCTTTGTCCAGTGTTAGTGTTTGGAATTTGTTTTATATTCTGG
rJMSF010K20+ CCATTCTTTCATACCTTCCTTTGTCCAGTGTTAGTGTTTGGAATTTGTTTTATATTCTGG
rJMSF035O12+ CCATTCTTTCATACCTTCCTTTGTCCAGTGTTAGTGTTTGGAATTTGTTTTATATTCTGG
rJMFF045K18+ CCATTCTTTCATACCTTCCTTTGTCCAGTGTTAGTGTTTGGAATTTGTTTTATATTCTGG
                      ____________________________________________________________
consensus CCATTCTTTCATACCTTCCTTTGTCCAGTGTTAGTGTTTGGAATTTGTTTTATATTCTGG
 
. : . : . : . : . : . :
rJMSF040A12+ CATCTTCA-CAGTTGTGCTTTAGCTTAAGATTGCCAGAC
rJMFF044P06+ CATC
rJMSF010K20+ CATCTTCA-CAGTTGTGCTTTAGCTTAAGATTGCCAGANCATGAT
rJMSF035O12+ CATCTTCACCAGTTGTGCTTTAGCTTAAGATTGCCAGACCATGATTTTGTGTATGCTAG
rJMFF045K18+ CATCTTCA-CAGTTGTGCTTTAGCTTAAGATTGCCAGA-CATGATTTTGTGTATGCTAGA
                      ____________________________________________________________
consensus CATCTTCA-CAGTTGTGCTTTAGCTTAAGATTGCCAGACCATGATTTTGTGTATGCTAGA
 
. : . : . : . : . : . :
rJMFF045K18+ TTCTAACTTAGCATTTGAACAAAACTCTTTTCACAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TTCTAACTTAGCATTTGAACAAAACTCTTTTCACAAAAAAAAAAAAAAACTCTCCAGGGT