Previous Contig 010566:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014G23Sequence451000746 (5)322010566 (4)
JMFF035C05Sequence542000746 (5)gb:AB022211_15149832e-04Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1L20.>gb:AY136450_158308010566 (4)
JMFF045K03Sequence521000746 (5)gb:AB022211_15149839e-06Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1L20.>gb:AY136450_158582010566 (4)pir|T45739|T457399e-35transcription factor-like protein - Arabidopsis thaliana>gb:ATF24M12_1549947 Ara
JMFF046F20Sequence435000746 (5)402010566 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045K03+ AGCAGCCAAGGCGGTGCAGCCATTGCGGCGTCCAGAAGACCCCA
                      ____________________________________________________________
consensus AGCAGCCAAGGCGGTGCAGCCATTGCGGCGTCCAGAAGACCCCA
 
. : . : . : . : . : . :
rJMFF045K03+ CAGTGGCGGGCCGGGCCGCTCGGAGCCAAGACGCTCTGCAACGCCTGTGGAGTCCGGTTC
                      ____________________________________________________________
consensus CAGTGGCGGGCCGGGCCGCTCGGAGCCAAGACGCTCTGCAACGCCTGTGGAGTCCGGTTC
 
. : . : . : . : . : . :
rJMFF045K03+ AAGTCCGGCCGCCTCCTCCCGGAGTACCGCCCCGCCTGCAGCCCCACCTTCTCCAGCCAG
                      ____________________________________________________________
consensus AAGTCCGGCCGCCTCCTCCCGGAGTACCGCCCCGCCTGCAGCCCCACCTTCTCCAGCCAG
 
. : . : . : . : . : . :
rJMFF046F20+ CGGAAAGTCCTCGAGATGCGGCGGAAGAAAGAATCGGAAGAC
rJMFF045K03+ CTCCACTCCAACAACCACCGGAAAGTCCTCGAGATGCGGCGGAAGAAAGAATCGGAAGAC
                      ____________________________________________________________
consensus CTCCACTCCAACAACCACCGGAAAGTCCTCGAGATGCGGCGGAAGAAAGAATCGGAAGAC
 
. : . : . : . : . : . :
rJMFF046F20+ TCGCCGGGATTCGCTCCGCCGGTCCAGAGTTTTTGAAAAAATTAAGGTTAACCCTTTAGG
rJMFF045K03+ TCGCCGGGATTCGCTCCGCCGGTCCAGAGTTTTTGAAAAAATTAAGGTTAACCCTTTAGG
                      ____________________________________________________________
consensus TCGCCGGGATTCGCTCCGCCGGTCCAGAGTTTTTGAAAAAATTAAGGTTAACCCTTTAGG
 
. : . : . : . : . : . :
rJMFF046F20+ CTTAGTTTGTTTCAAAAAAAAAAAAAACCCTTTAGGCTTAGTAGTAGACTAGTAGTTGTC
rJMFF035C05+ AAAAAAAAAAAACCCTTTAGGCTTAGTAGTAGACTAGTAGTTGTC
rJMFF014G23+ AAAAAAAAAAAACCCTTTAGGCTTAGTAGTAGACTAGTAGTTGTC
rJMFF045K03+ CTTAGTTTGTTTC--AAAAAAAAAAAACCCTTTAGGCTTAGTAGTAGACTAGTAGTTGTC
                      ____________________________________________________________
consensus CTTAGTTTGTTTCAAAAAAAAAAAAAACCCTTTAGGCTTAGTAGTAGACTAGTAGTTGTC
 
. : . : . : . : . : . :
rJMFF046F20+ AGAAATAGCGTAAAACGCAAAAAGAAAGAAGAAAAAAAACCCGGAAATTTTAGGGATAGC
rJMFF035C05+ AGAAATAGCGTAAAACGCAAAAAGAAAGAAGAAAAAAAACCCGGAAATTTTAGGGATAGC
rJMFF014G23+ AGAAATAGCGTAAAACGCAAAAAGAAAGAAGAAAAAAAACCCGGAAATTTTAGGGATAGC
rJMFF045K03+ AGAAATAGCGTAAAACGCAAAAAGAAAGAAGAAAAAAAACCCGGAAATTTTAGGGATAGC
                      ____________________________________________________________
consensus AGAAATAGCGTAAAACGCAAAAAGAAAGAAGAAAAAAAACCCGGAAATTTTAGGGATAGC
 
. : . : . : . : . : . :
rJMFF046F20+ GAGACGACAAAAAACCGGAGTCGAATTGTTGAGAGGTTAGATCGGGTCGATTAAGAACCG
rJMFF035C05+ GAGACGACAAAAAACCGGAGTCGAATTGTTGAGAGGTTAGATCGGGTCGATTAAGAACCG
rJMFF014G23+ GAGACGACAAAAAACCGGAGTCGAATTGTTGAGAGGTTAGATCGGGTCGATTAAGAACCG
rJMFF045K03+ GAGACGACAAAAAACCGGAGTCGAATTGTTGAGAGGTTAGATCGGGTCGATTAAGAACCG
                      ____________________________________________________________
consensus GAGACGACAAAAAACCGGAGTCGAATTGTTGAGAGGTTAGATCGGGTCGATTAAGAACCG
 
. : . : . : . : . : . :
rJMFF046F20+ GTTCAGTGTACATTTTTTAGGGGTAGACCGGCAGACCGCTGGTTGGTGCGGTAGGTTTTC
rJMFF035C05+ GTTCAGTGTACATTTTTTAGGGGTAGACCGGCAGACCGCTGGTTGGTGCGGTAGGTTTTC
rJMFF014G23+ GTTCAGTGTACATTTTTTAGGGGTAGACCGGCAGNCCGCTGGTTGGTGCGGTAGGTTTTC
rJMFF045K03+ GTTCAGTGTACATTTTTTAGGGGTAGACCGGCAGACCGCTGGTTGGTGCGGTAGGTTTTC
                      ____________________________________________________________
consensus GTTCAGTGTACATTTTTTAGGGGTAGACCGGCAGACCGCTGGTTGGTGCGGTAGGTTTTC
 
. : . : . : . : . : . :
rJMFF046F20+ GAGTGTTAGTGTAACGTATGAGGACTGAGGAGAGGCTTTTAATGTACTTTCCCTTTAAAC
rJMFF035C05+ GAGTGTTAGTGTAACGTATGAGGACTGAGGAGAGGC
rJMFF014G23+ GAGTGTTAGTGTAACGTATGAGGACTGAGGAGAGGC
rJMFF045K03+ GAGTGTTAGTGTAACGTATGAGGACTGAGGAGAGGCTTTTAATGTACTTTCCCTTTAAAC
                      ____________________________________________________________
consensus GAGTGTTAGTGTAACGTATGAGGACTGAGGAGAGGCTTTTAATGTACTTTCCCTTTAAAC