Previous Contig 010565:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045K02Sequence655001943 (2)gb:AY568527_16154655e-60Arabidopsis thaliana multidomain cyclophilin type peptidyl-prolyl cis-trans isom634010565 (2)
JMSF013F02Sequence318001943 (2)gb:AY568527_16154651e-08Arabidopsis thaliana multidomain cyclophilin type peptidyl-prolyl cis-trans isom704010565 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013F02+ TATTATGGTGGAAGGAACA
                      ____________________________________________________________
consensus TATTATGGTGGAAGGAACA
 
. : . : . : . : . : . :
rJMSF013F02+ TTCAAAGAAATCGTGATAATAGGTATTCAAGCTACAGAAACTATTCTGATCGCTCTCCAC
                      ____________________________________________________________
consensus TTCAAAGAAATCGTGATAATAGGTATTCAAGCTACAGAAACTATTCTGATCGCTCTCCAC
 
. : . : . : . : . : . :
rJMSF013F02+ CAAGACGCTATAGAGGTTCTCCAAAAGGGAGGAGTCCGCCTAGATACCGATACAGGGGTA
                      ____________________________________________________________
consensus CAAGACGCTATAGAGGTTCTCCAAAAGGGAGGAGTCCGCCTAGATACCGATACAGGGGTA
 
. : . : . : . : . : . :
rJMSF013F02+ GAAGTAGGAGTGTATCTCGAAGCCCTAATGATTCCCCCTCAAGCAAAAAGCACAACAGGT
rJMFF045K02+ AATGATTCCCCCTCAAGCAAAAAGCACAACAGGT
                      ____________________________________________________________
consensus GAAGTAGGAGTGTATCTCGAAGCCCTAATGATTCCCCCTCAAGCAAAAAGCACAACAGGT
 
. : . : . : . : . : . :
rJMSF013F02+ CCCCTTCACGCAGCCGTAGCCCTGTGGATAGGCGGCCAGCAATTAGTGATAGGTTAAAGT
rJMFF045K02+ CCCCTTCACGCAGCCGTAGCCCTGTGGATAGGCGGCCAGCAATTAGTGATAGGTTAAAGT
                      ____________________________________________________________
consensus CCCCTTCACGCAGCCGTAGCCCTGTGGATAGGCGGCCAGCAATTAGTGATAGGTTAAAGT
 
. : . : . : . : . : . :
rJMSF013F02+ CTCGGCTTGGGCCTCGAGTGGATAACCAGAAACCATCAAGTCGAGGAAGGTCGAAATCGA
rJMFF045K02+ CTCGGCTTGGGCCTCGAGTGGATAACCAGAAACCATCAAGTCGAGGAAGGTCGAAATCGA
                      ____________________________________________________________
consensus CTCGGCTTGGGCCTCGAGTGGATAACCAGAAACCATCAAGTCGAGGAAGGTCGAAATCGA
 
. : . : . : . : . : . :
rJMSF013F02+ GGTCACGAAGCCGTGGTGCATCTCATTCTAGTTCACCTGAAACTGCTCCCAGGAAGCATG
rJMFF045K02+ GGTCACGAAGCCGTGGTGCATCTCATTCTAGTTCACCTGAAACTGCTCCCAGGAAGCATG
                      ____________________________________________________________
consensus GGTCACGAAGCCGTGGTGCATCTCATTCTAGTTCACCTGAAACTGCTCCCAGGAAGCATG
 
. : . : . : . : . : . :
rJMSF013F02+ CAAGGAATGCATCACATAGTTCCAGATCCAGATCCAGCTCCCCAGATGGTAAGAGGGGTT
rJMFF045K02+ CAAGGAATGCATCACATAGTTCCAGATCCAGATCCAGCTCCCCAGATGGTAAGAGGGGTT
                      ____________________________________________________________
consensus CAAGGAATGCATCACATAGTTCCAGATCCAGATCCAGCTCCCCAGATGGTAAGAGGGGTT
 
. : . : . : . : . : . :
rJMSF013F02+ TGGTTTCCTATGAGGACATAAGTCCTGGAAATGGGACAGATTAGTTGGCGAGGTTATGCT
rJMFF045K02+ TGGTTTCCTATGAGGACATAAGTCCTGGAAATGGGACAGATTAGTTGGCGAGGTTATGCT
                      ____________________________________________________________
consensus TGGTTTCCTATGAGGACATAAGTCCTGGAAATGGGACAGATTAGTTGGCGAGGTTATGCT
 
. : . : . : . : . : . :
rJMSF013F02+ CACAAGTCACAAGTACTGAATCATGATGTCAGGATACAGTTATATTGGTTTTGGCCGTTT
rJMFF045K02+ CACAAGTCACAAGTACTGAATCATGATGTCAGGATACAGTTATATTGGTTTTGGCCGTTT
                      ____________________________________________________________
consensus CACAAGTCACAAGTACTGAATCATGATGTCAGGATACAGTTATATTGGTTTTGGCCGTTT
 
. : . : . : . : . : . :
rJMSF013F02+ ATTTATCTTTAACATGATGACTGACTTTGTTTTAGGTTTTTTGTTTATCCTCCCCTATGA
rJMFF045K02+ ATTTATCTTTAACATGATGACTGACTTTGTTTTAGGTTTTTTGTTTATCCTCCCCTATGA
                      ____________________________________________________________
consensus ATTTATCTTTAACATGATGACTGACTTTGTTTTAGGTTTTTTGTTTATCCTCCCCTATGA
 
. : . : . : . : . : . :
rJMSF013F02+ ATGCTATTTCATATGTAGGGGGTTTTACTTACATTTTGAAAAAGTTTGC--TTATTTATG
rJMFF045K02+ ATGCTATTTCATATGTAGGGGGTTTTACTTACATTTTGAAAAAGTTTGCTTTTATTTATG
                      ____________________________________________________________
consensus ATGCTATTTCATATGTAGGGGGTTTTACTTACATTTTGAAAAAGTTTGCTTTTATTTATG
 
. : . : . : . : . : . :
rJMSF013F02+ CAATGAGAACCTTAATGGATGTTAATA
rJMFF045K02+ CAATGAGAACCTTAATGGATGTTAATAGGTTTAGTATTATATTAATATAAAATGTTCAAT
                      ____________________________________________________________
consensus CAATGAGAACCTTAATGGATGTTAATAGGTTTAGTATTATATTAATATAAAATGTTCAAT
 
. : . : . : . : . : . :
rJMFF045K02+ TTAGTCTTTAAAAAAAAAAAGAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTAGTCTTTAAAAAAAAAAAGAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG