Previous Contig 010564:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025E21Sequence558007434 (6)gb:AY054674_15633282e-61Arabidopsis thaliana Unknown protein (At5g67130; K21H1.9) mRNA, complete cds.>gb740010564 (6)gb:AY087841_15728681e-48Arabidopsis thaliana clone 38897 mRNA, complete sequence.
JMFF025P15Sequence527007434 (6)gb:AY087841_15728688e-55Arabidopsis thaliana clone 38897 mRNA, complete sequence.786010564 (6)gb:AY087841_15728681e-57Arabidopsis thaliana clone 38897 mRNA, complete sequence.
JMFF035B16Sequence572007434 (6)gb:AY054674_15633288e-63Arabidopsis thaliana Unknown protein (At5g67130; K21H1.9) mRNA, complete cds.>gb789010564 (6)gb:AY087841_15728686e-59Arabidopsis thaliana clone 38897 mRNA, complete sequence.
JMFF045K01Sequence557007434 (6)gb:AY054674_15633287e-61Arabidopsis thaliana Unknown protein (At5g67130; K21H1.9) mRNA, complete cds.>gb648010564 (6)gb:AY087841_15728683e-26Arabidopsis thaliana clone 38897 mRNA, complete sequence.
JMSF033F20Sequence725007434 (6)gb:AY054674_15633289e-90Arabidopsis thaliana Unknown protein (At5g67130; K21H1.9) mRNA, complete cds.>gb750010564 (6)gb:AY087841_15728682e-50Arabidopsis thaliana clone 38897 mRNA, complete sequence.
JMSF041K24Sequence796007434 (6)gb:AY054674_15633281e-62Arabidopsis thaliana Unknown protein (At5g67130; K21H1.9) mRNA, complete cds.>gb623010564 (6)gb:AY087841_15728681e-24Arabidopsis thaliana clone 38897 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035B16+ GAAG
                      ____________________________________________________________
consensus GAAG
 
. : . : . : . : . : . :
rJMFF035B16+ GAATCGCTTACCAGTGGAGATACATGGTGGAAAATGAGCCTGGAGATCCTGGGGTGGTGC
rJMSF033F20+ AGTGGAGATACATGGT-GAAAATGAGCCTGGAGATCCTGGGGTGGTGC
rJMFF025P15+ AATCGCTTACCAGTGGAGATACATGGTGGAAAATGAGCCTGGAGATCCTGGGGTGGTGC
rJMFF025E21+ CCTGGGGTGGTGC
                      ____________________________________________________________
consensus GAATCGCTTACCAGTGGAGATACATGGTGGAAAATGAGCCTGGAGATCCTGGGGTGGTGC
 
. : . : . : . : . : . :
rJMFF035B16+ CTGGCTCGTGCTCCAATAGAAAGGAATCAAAGCCTCTTAATTCGAGAAGTGCCTCGCTCT
rJMSF033F20+ CTGGCTCGTGCTCCAATAGAAAGGAATCAAAGCCTCTTAATTCGAGAAGTGCCTCGCTCT
rJMFF025P15+ CTGGCTCGTGCTCCAATAGAAAGGAATCAAAGCCTCTTAATTCGAGAAGTGCCTCGCTCT
rJMFF025E21+ CTGGCTCGTGCTCCAATAGAAAGGAATCAAAGCCTCTTAATTCGAGAAGTGCCTCGCTCT
                      ____________________________________________________________
consensus CTGGCTCGTGCTCCAATAGAAAGGAATCAAAGCCTCTTAATTCGAGAAGTGCCTCGCTCT
 
. : . : . : . : . : . :
rJMFF035B16+ TTCTAATGAATTACTTCCCTACAATTCCTGCTCAAAATGAAGTTTGCAAAGAACATTCTA
rJMSF033F20+ TTCTAATGAATTACTTCCCTACAATTCCTGCTCAAAATGAAGTTTGCAAAGAACATTCTA
rJMFF025P15+ TTCTAATGAATTACTTCCCTACAATTCCTGCTCAAAATGAAGTTTGCAAAGAACATTCTA
rJMSF041K24+ CCTGCTCAAAATGAAG-TTGCAAAGAACATTCTA
rJMFF025E21+ TTCTAATGAATTACTTCCCTACAATTCCTGCTCAAAATGAAGTTTGCAAAGAACATTCTA
                      ____________________________________________________________
consensus TTCTAATGAATTACTTCCCTACAATTCCTGCTCAAAATGAAGTTTGCAAAGAACATTCTA
 
. : . : . : . : . : . :
rJMFF035B16+ CTCCACTAGCTGATATGGTTGGCACTTGTTATAAAGCAGCCGGGAATTTGATGCCAAATT
rJMSF033F20+ CTCCACTAGCTGATATGGTTGGCACTTGTTATAAAGCAGCCGGGAATTTGATGCCAAATT
rJMFF025P15+ CTCCACTAGCTGATATGGTTGGCACTTGTTATAAAGCAGCCGGGAATTTGATGCCAAATT
rJMSF041K24+ CTCCACTAGCTGATATGGTTGGCACTTGTTATAAAGCAGCCGGGAATTTGATGCCAAATT
rJMFF025E21+ CTCCACTAGCTGATATGGTTGGCACTTGTTATAAAGCAGCCGGGAATTTGATGCCAAATT
rJMFF045K01+ GATATGGTTGGCACTTGTTATAAAGCAGCCGGGAATNTGATGCCAAATT
                      ____________________________________________________________
consensus CTCCACTAGCTGATATGGTTGGCACTTGTTATAAAGCAGCCGGGAATTTGATGCCAAATT
 
. : . : . : . : . : . :
rJMFF035B16+ TTGTGGCAGTAAACTTTTACATGAGGAGCGATGGAGGGGGTG-TTTTTGATGATTTGGAT
rJMSF033F20+ TTGTGGCAGTAAACCTTTACATGAGGAGCGATGGAGGGGGTG-TTTTTGATGATTTGGAT
rJMFF025P15+ TTGTGGCAGTAAACTTTTACATGAGGAGCGATGGAGGGGGTG-TTTTTGATGATTTGGAT
rJMSF041K24+ TTGTGGCAGTAAACTTTTACATGAGGAGCGATGGAGGGGGTGTTTTTTGATGATTTGGAT
rJMFF025E21+ TTGTGGCAGTAAACTTTTACATGAGGAGCGATGGAGGGGGTG-TTTTTGATGATTTGGAT
rJMFF045K01+ TTGTGGCAGTAAACTTTTACATGAGGAGCGATGGAGGGGGTG-TTTTTGATGATTTGGAT
                      ____________________________________________________________
consensus TTGTGGCAGTAAACTTTTACATGAGGAGCGATGGAGGGGGTG-TTTTTGATGATTTGGAT
 
. : . : . : . : . : . :
rJMFF035B16+ CGAATGAATGGTCAGTCTTTGTGCGGCTGCACTACAATAACTGCTTGCCAGGCAGGAGAA
rJMSF033F20+ CGAATGGATGGTCAGTCTTTGTGCGGCTGCACTACAATAACTGCTTGCCAGGCAGGAGAA
rJMFF025P15+ CGAATGAATGGTCAGTCTTTGTGCGGCTGCACTACAATAACTGCTTGCCAGGCAGGAGAA
rJMSF041K24+ CGAATGAATGGTCAGTCTTTGTGCGGCTGCACTACAATAACTGCTTGCCAGGCAGGAGAA
rJMFF025E21+ CGAATGAATGGTCAGTCTTTGTGCGGCTGCACTACAATAACTGCTTGCCAGGCAGGAGAA
rJMFF045K01+ CGAATGAATGGTCAGTCTTTGTGCGGCTGCACTACAATAACTGCTTGCCAGGCAGGAGAA
                      ____________________________________________________________
consensus CGAATGAATGGTCAGTCTTTGTGCGGCTGCACTACAATAACTGCTTGCCAGGCAGGAGAA
 
. : . : . : . : . : . :
rJMFF035B16+ CATTTTGGAGTTTGCAAGAATGTTGCTGCATCTAATACAACTCCAGGGACAACTGACCCT
rJMSF033F20+ CATTTTGGAGTTTGCAAGAATGTTGCTGCATCTAATACAACTCCAGGGACAACTGACCCT
rJMFF025P15+ CATTTTGGAGTTTGCAAGAATGTTGCTGCATCTAATACAACTCCAGGGACAACTGACCCT
rJMSF041K24+ CATTTTGGAGTTTGCAAGAATGTTGCTGCATCTAATACAACTCCAGGGACAACTGACCCT
rJMFF025E21+ CATTTTGGAGTTTGCAAGAATGTTGCTGCATCTAATACAACTCCAGGGACAACTGACCCT
rJMFF045K01+ CATTTTGGAGTTTGCAAGAATGTTGCTGCATCTAATACAACTCCAGGGACAACTGACCCT
                      ____________________________________________________________
consensus CATTTTGGAGTTTGCAAGAATGTTGCTGCATCTAATACAACTCCAGGGACAACTGACCCT
 
. : . : . : . : . : . :
rJMFF035B16+ GCAGGAAGCTTTTCTGGGTCTGTGCAATTGACAGGGTCTGCTTCAGCCATCAAAGTCGAA
rJMSF033F20+ GCAGGAAGCTTTTCTGGGTCTGTGCAATTGACAGGGTCTGCTTCAGCCATCAAAGTCGAA
rJMFF025P15+ GCAGGAAGCTTTTCTGGGTCTGTGCAATTGACAGGGTCTGCTTCAGCCATCAAAGTCGAA
rJMSF041K24+ GCAGGAAGCTTTTCTGGGTCTGTGCAATTGACAGGGTCTGCTTCAGCCATCAAAGTCGAA
rJMFF025E21+ GCAGGAAGCTTTTCTGGGTCTGTGCAATTGACAGGGTCTGCTTCAGCCATCAAAGTCGAA
rJMFF045K01+ GCAGGAAGCTTTTCTGGGTCTGTGCAATTGACAGGGTCTGCTTCAGCCATCAAAGTCGAA
                      ____________________________________________________________
consensus GCAGGAAGCTTTTCTGGGTCTGTGCAATTGACAGGGTCTGCTTCAGCCATCAAAGTCGAA
 
. : . : . : . : . : . :
rJMFF035B16+ AGTATATTTTACGCGTTCTTTCTCTTCTGGCCTGTGGTGTTGTTGTTTCTCGTATGATTA
rJMSF033F20+ AGTATATTTTACGCGTTCTTTCTCTTCTGGCCTGTGGTGTTGTTGTTTCTCGTATGATTA
rJMFF025P15+ AGTATATTTTACGCGTTCTTTCTCTTCTGGCCTGTGGTGTTGTTGTTTCTCGTATGATTA
rJMSF041K24+ AGTATATTTTACGCGTTCTTTCTCTTCTGGCCTGTGGTGTTGTTGTTTCTCGTATGATTA
rJMFF025E21+ AGTATATTTTACGCGTTCTTTCTCTTCTGGCCTGTGGTGTTGTTGTTTCTCGTATGATTA
rJMFF045K01+ AGTATATTTTACGCGTTCTTTCTCTTCTGGCCTGTGGTGTTGTTGTTTCTCGTATGATTA
                      ____________________________________________________________
consensus AGTATATTTTACGCGTTCTTTCTCTTCTGGCCTGTGGTGTTGTTGTTTCTCGTATGATTA
 
. : . : . : . : . : . :
rJMFF035B16+ GCGGGAAGTGATCGAGTTCTATGGTAGAATGTGTTGCTGCATTGTTGAGTGCTGGTTAGG
rJMSF033F20+ GCGGGAAGTGATCGAGTTCTATGGTAGAATGTGTTGCTGCATTGTTGAGTGCTGGTTAGG
rJMFF025P15+ GCGGGAAGTGATCGAGTTCTATGGTAGAATGTGTTGCTGCATTGTTGAGTGCTGGTTAGG
rJMSF041K24+ GCGGGAAGTGATCGAGTTCTATGGTAGAATGTGTTGCTGCATTGTTGAGTGCTGGTTAGG
rJMFF025E21+ GCGGGAAGTGATCGAGTTCTATGGTAGAATGTGTTGCTGCATTGTTGAGTGCTGGTTAGG
rJMFF045K01+ GCGGGAAGTGATCGAGTTCTATGGTAGAATGTGTTGCTGCATTGTTGAGTGCTGGTTAGG
                      ____________________________________________________________
consensus GCGGGAAGTGATCGAGTTCTATGGTAGAATGTGTTGCTGCATTGTTGAGTGCTGGTTAGG
 
. : . : . : . : . : . :
rJMFF035B16+ CCTTCACTGTGTAAAGTTTTGAGTCAGAAAGGTACTCATTTTGGCCTGTTAAAACTAGAA
rJMSF033F20+ CCTTCACTGTGTAAAGTTTTGAGTCAGAAAGGTACTCATTTTGGCCTGTTAAAACTAGAA
rJMFF025P15+ CCTTCACTGTGTAAAGTTTTGAGTCAGAAAGGTACTCATTTTGGCCTGTTAAAACTAGAA
rJMSF041K24+ CCTTCACTGTGTAAAGTTTTGAGTCAGAAAGGTACTCATTTTGGCCTGTTAAAACTAGAA
rJMFF025E21+ CCTTCACTGTGTAAAGTTTTGAGTCAGAAAGGTACTCATTTTGGCCTGTTAAAACTAGAA
rJMFF045K01+ CCTTCACTGTGTAAAGTTTTGAGTCAGAAAGGTACTCATTTTGGCCTGTTAAAACTAGAA
                      ____________________________________________________________
consensus CCTTCACTGTGTAAAGTTTTGAGTCAGAAAGGTACTCATTTTGGCCTGTTAAAACTAGAA
 
. : . : . : . : . : . :
rJMFF035B16+ AACATTCACCTTAGAATGTTAAGGCAAAAGTCTAGGTAATCAGTGTTATAGTTTAGCAGA
rJMSF033F20+ AACATTCACCTTAGAATGTTAAGGCAAAAGTCTAGGTAATCAGTGTTATAGTTTAGCAGA
rJMFF025P15+ AACATTCACCTTAGAATGTTAAGGCAAAAGTCTAGGTAATCAGTGTTATAGTTTAGCAGA
rJMSF041K24+ AACATTCACCTTAGAATGTTAAGGCAAAAGTCTAGGTAATCAGTGTTATAGTTTAGCAGA
rJMFF025E21+ AACATTCACCTTAGAATGTTAAGGCAAAAGTCTAGGTAATCAGTGTTATAGTTTAGCAGA
rJMFF045K01+ AACATTCACCTTAGAATGTTAAGGCAAAAGTCTAGGTAATCAGTGTTATAGTTTAGCAGA
                      ____________________________________________________________
consensus AACATTCACCTTAGAATGTTAAGGCAAAAGTCTAGGTAATCAGTGTTATAGTTTAGCAGA
 
. : . : . : . : . : . :
rJMFF035B16+ GATGGCTACAGCCTGCAACAAGTAAACTGTACTCAACATTATCCAGA-TTTGTGTTTA-A
rJMSF033F20+ GATGGCTACAGCCTGCAACAAGTAAACTGTACTCAACAT
rJMFF025P15+ GATGGCTACAGCCTGCAACAAGTAAACTGTACTCAACATTATCCAGA-TTTGTGTTTATA
rJMSF041K24+ GATGGCTACAGCCTGCAACAAGTAAACTGTACTCAACA-TATCCAGATT
rJMFF025E21+ GATGGCTACAGCCTGCAACAAGTAAACTGTACTCAACATTATCCAGA-TTTGTGTTTATA
rJMFF045K01+ GATGGCTACAGCCTGCAACAAGTAAACTGTACTCAACATTATCCAGAGTTTGTGTTTATA
                      ____________________________________________________________
consensus GATGGCTACAGCCTGCAACAAGTAAACTGTACTCAACATTATCCAGA-TTTGTGTTTATA
 
. : . : . : . : . : . :
rJMFF035B16+ AAACCCCC
rJMFF025P15+ AAACCCCC
rJMFF025E21+ AAACCCCC
rJMFF045K01+ AAACCCCCCATGATTTTTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AAACCCCCCATGATTTTTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG