Previous Contig 010559:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045J11Sequence595010559 (2)gb:AF072533_17658807e-53Capsicum annuum pepper esterase (PepEST) mRNA, complete cds.645010559 (2)gb:AF072533_17658805e-48Capsicum annuum pepper esterase (PepEST) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045J11- GTCACAAACC
                      ____________________________________________________________
consensus GTCACAAACC
 
. : . : . : . : . : . :
JMFF045J11- ATTACTCCTTAGCTTCTAACTGTTTTACAGATTTCGATCTTAGATGTTGACAATGGAACG
                      ____________________________________________________________
consensus ATTACTCCTTAGCTTCTAACTGTTTTACAGATTTCGATCTTAGATGTTGACAATGGAACG
 
. : . : . : . : . : . :
JMFF045J11- AAAAGAAATTATCCGTCCGGTAATAGACAACCCTTTCCTCAACATCGTCGAATTACCCGG
                      ____________________________________________________________
consensus AAAAGAAATTATCCGTCCGGTAATAGACAACCCTTTCCTCAACATCGTCGAATTACCCGG
 
. : . : . : . : . : . :
JMFF045J11- CGACACCGTCAAACGTGACCCCGAACCTCTCAACGCCCCCAACACCGACCTCCATGGCAG
                      ____________________________________________________________
consensus CGACACCGTCAAACGTGACCCCGAACCTCTCAACGCCCCCAACACCGACCTCCATGGCAG
 
. : . : . : . : . : . :
JMFF045J11- CTCGCCGGTACTCTCCAAGGATGTCAGCCTCGACCCAAACAAAGGCACCTGGCAACGATT
                      ____________________________________________________________
consensus CTCGCCGGTACTCTCCAAGGATGTCAGCCTCGACCCAAACAAAGGCACCTGGCAACGATT
 
. : . : . : . : . : . :
JMFF045J11- ATATATCCCGAAAGATGTTATGATCAACCTCTTCTTCTTCTTATTCTTCCCCGAAGAAAC
                      ____________________________________________________________
consensus ATATATCCCGAAAGATGTTATGATCAACCTCTTCTTCTTCTTATTCTTCCCCGAAGAAAC
 
. : . : . : . : . : . :
JMFF045J11- TACCTCTGATTGTGTACTATCACGGCGGAGGATATGTTTTTAACCACGCAAACTCGAGTT
                      ____________________________________________________________
consensus TACCTCTGATTGTGTACTATCACGGCGGAGGATATGTTTTTAACCACGCAAACTCGAGTT
 
. : . : . : . : . : . :
JMFF045J11- TGTACGATGTTTTTTGCCAGGGTTTGGTGGAGAAGGTGGGGGTTATGGTAATTTCACTCG
                      ____________________________________________________________
consensus TGTACGATGTTTTTTGCCAGGGTTTGGTGGAGAAGGTGGGGGTTATGGTAATTTCACTCG
 
. : . : . : . : . : . :
JMFF045J11- AGTACCGTCTCGCCCCGGAGCACCGCTTGCCGGCGGCGTATGAAGACGCCGTGGACGGGC
                      ____________________________________________________________
consensus AGTACCGTCTCGCCCCGGAGCACCGCTTGCCGGCGGCGTATGAAGACGCCGTGGACGGGC
 
. : . : . : . : . : . :
JMFF045J11- TGAGGTGGGTGAGCTCGACCCAAGACGAGTGGGTCCGCAACTTCGCGGATTTGGACNACT
rJMFF045J11+ CGACCCAAGACGAGTGGGTCCGCAACTTCGCGGATTTGGACAACT
                      ____________________________________________________________
consensus TGAGGTGGGTGAGCTCGACCCAAGACGAGTGGGTCCGCAACTTCGCGGATTTGGACAACT
 
. : . : . : . : . : . :
JMFF045J11- GTTATCTTTCCGGCACCAGCGCCGGCGGAAACCTTGCTTACTTTG
rJMFF045J11+ GTTATCTTTCCGGCACCAGCGCCGGCGGAAACCTTGCTTACTTTGCCGGGATAAGGGCGG
                      ____________________________________________________________
consensus GTTATCTTTCCGGCACCAGCGCCGGCGGAAACCTTGCTTACTTTGCCGGGATAAGGGCGG
 
. : . : . : . : . : . :
rJMFF045J11+ CGGCGGCGGCGGAAGAGCTCAAGCCGCTTAATATCAAGGGGATGATCTTGCACCATCCAT
                      ____________________________________________________________
consensus CGGCGGCGGCGGAAGAGCTCAAGCCGCTTAATATCAAGGGGATGATCTTGCACCATCCAT
 
. : . : . : . : . : . :
rJMFF045J11+ ATTTTAGCGGGAAGACGAGGTCGGAATCCGAGGAGAGGCTCAAAAACGATTCCATTTTGC
                      ____________________________________________________________
consensus ATTTTAGCGGGAAGACGAGGTCGGAATCCGAGGAGAGGCTCAAAAACGATTCCATTTTGC
 
. : . : . : . : . : . :
rJMFF045J11+ CGCTGTACGCGATTGATCAGATGTATGGTCTGTGTTTGCCGAAGGGTGCCGGCGGCGATC
                      ____________________________________________________________
consensus CGCTGTACGCGATTGATCAGATGTATGGTCTGTGTTTGCCGAAGGGTGCCGGCGGCGATC
 
. : . : . : . : . : . :
rJMFF045J11+ ATGAGTTCCGGAACCCGGGCGTCGACGGCGGGTCGAAACATCTTGAGGATATAAAGAGGT
                      ____________________________________________________________
consensus ATGAGTTCCGGAACCCGGGCGTCGACGGCGGGTCGAAACATCTTGAGGATATAAAGAGGT
 
. : . : . : . : . : . :
rJMFF045J11+ TAGGTTGGCGGGTCCTCGTGACGGGTTGCTCCGATGACCCGTTGGTGGATGCCGGTAAGC
                      ____________________________________________________________
consensus TAGGTTGGCGGGTCCTCGTGACGGGTTGCTCCGATGACCCGTTGGTGGATGCCGGTAAGC
 
. : . : . : . : . : . :
rJMFF045J11+ AGTGTGCGAAGTTGCTGGAAGGGAAGGGGATTCCGACAACGGCGTCGTTTGGGGAAGGAT
                      ____________________________________________________________
consensus AGTGTGCGAAGTTGCTGGAAGGGAAGGGGATTCCGACAACGGCGTCGTTTGGGGAAGGAT
 
. : . : . : . : . : . :
rJMFF045J11+ ATCATGGGATGGAGGTTTTCGACCACTCCATGTCGGGCCCACTTTATCATGTAATCAAGA
                      ____________________________________________________________
consensus ATCATGGGATGGAGGTTTTCGACCACTCCATGTCGGGCCCACTTTATCATGTAATCAAGA
 
. : . : . : . : . : . :
rJMFF045J11+ ATTTCATTTCTTGATTTTTGATTTTTGTTTGGGATTGGATATTTGAATATTGTAATAAGA
                      ____________________________________________________________
consensus ATTTCATTTCTTGATTTTTGATTTTTGTTTGGGATTGGATATTTGAATATTGTAATAAGA
 
. : . : . : . : . : . :
rJMFF045J11+ TGAATTTTGATAAGGACTGCTAAACCTCTAGCTAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGAATTTTGATAAGGACTGCTAAACCTCTAGCTAAAAAAAAAAAAAAAACTCTCCAGGGT