Previous Contig 010557:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018K01Sequence385010557 (3)
JMFF042E05Sequence642001801 (2)pir|T04745|T047454e-29hypothetical protein F6G17.160 - Arabidopsis thaliana>gb:ATCHRIV87_1547705 Arabi598010557 (3)pir|T04745|T047453e-22hypothetical protein F6G17.160 - Arabidopsis thaliana>gb:ATCHRIV87_1547705 Arabi
JMFF045J06Sequence592001801 (2)pir|T04745|T047455e-23hypothetical protein F6G17.160 - Arabidopsis thaliana>gb:ATCHRIV87_1547705 Arabi407010557 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF042E05+ CAGCGAGGAAGTCCAGGATGCATACGA
                      ____________________________________________________________
consensus CAGCGAGGAAGTCCAGGATGCATACGA
 
. : . : . : . : . : . :
rJMFF042E05+ GCACAACCGGAGGTTGAGAAATCCAGCCACGACTTCGGTTCAACAAGCCATTCACGGTGT
                      ____________________________________________________________
consensus GCACAACCGGAGGTTGAGAAATCCAGCCACGACTTCGGTTCAACAAGCCATTCACGGTGT
 
. : . : . : . : . : . :
rJMFF018K01+ T
rJMFF042E05+ GTCATATGCCGTATATGGGAAACCAGATGTCCGACGCCTCATGTTTGAGGTTTTCGACTT
                      ____________________________________________________________
consensus GTCATATGCCGTATATGGGAAACCAGATGTCCGACGCCTCATGTTTGAGGTTTTCGACTT
 
. : . : . : . : . : . :
rJMFF018K01+ TGAGCAAACCCATCCGNAGGCAGTATNAGGCCTCGGTTNGAGACATAGCAGCACGGTGTT
rJMFF042E05+ TGAGCAAACCCAACCGAAGGCAGTTTAAGGCCTCGGTTTGAGACATAGCAGCACGGTGTT
                      ____________________________________________________________
consensus TGAGCAAACCCATCCGAAGGCAGTTTAAGGCCTCGGTTTGAGACATAGCAGCACGGTGTT
 
. : . : . : . : . : . :
rJMFF018K01+ NTNCCNTAGTCTGAAGATTCATCGTCAGATTGACAAGAAAAGTAGAAGAGGTTNGAAATT
rJMFF042E05+ CTACCCTAGTCTGAAGATTCATCGTCAGATTGACAAGAAAAGTAGAAGAGGTTCGAAATT
rJMFF045J06+ GAAGATTCATCGTCAGATTGACAAGAAAAGTAGAAGAGGTTCGAAATT
                      ____________________________________________________________
consensus CTACCCTAGTCTGAAGATTCATCGTCAGATTGACAAGAAAAGTAGAAGAGGTTCGAAATT
 
. : . : . : . : . : . :
rJMFF018K01+ GTTTGTAGTGAGAGATTGAGATTGCAGATGAGAGGAATGTACAGTTTTCCCCCAATTCCC
rJMFF042E05+ GTTTGTAGTGAGAGATTGAGATTGCAGATGAGAGGAATGTACAGTTTTCCCCCAATTCCC
rJMFF045J06+ GTTTGTAGTGAGAGATTGAGATTGCAGATGAGAGGAATGTACAGTTTTCCCCCAATTCCC
                      ____________________________________________________________
consensus GTTTGTAGTGAGAGATTGAGATTGCAGATGAGAGGAATGTACAGTTTTCCCCCAATTCCC
 
. : . : . : . : . : . :
rJMFF018K01+ ATGTTAAGATGTNCATCAAATGTACTTGAGTTGTATAAGATGAGATTNTGATTCTCATGG
rJMFF042E05+ ATGTTAAGATGTACATCAAATGTACTTGAGTTGTATAAGATGAGATTCTGATTCTCATGG
rJMFF045J06+ ATGTTAAGATGTACATCAAATGTACTTGAGTTGTATAAGATGAGATTTTGATTCTCATGG
                      ____________________________________________________________
consensus ATGTTAAGATGTACATCAAATGTACTTGAGTTGTATAAGATGAGATTTTGATTCTCATGG
 
. : . : . : . : . : . :
rJMFF018K01+ ATTCAAACTATAAAATCTTAGAGAGAGAGAGAAAAGCCAGGTTTTAGGGCAAAGTGGGGG
rJMFF042E05+ ATTCAAACTATAAAATCTTAGAGAGAGAGAGAAAAGCCAGGTTTTAGGGCAAAGTGGGGG
rJMFF045J06+ ATTCAAACTATAAAATCTTAGAGAGAGAGAGAAAAGCCAGGTTTTAGGGCAAAGTGGGGG
                      ____________________________________________________________
consensus ATTCAAACTATAAAATCTTAGAGAGAGAGAGAAAAGCCAGGTTTTAGGGCAAAGTGGGGG
 
. : . : . : . : . : . :
rJMFF018K01+ TTCTAGTGACAGAGAGAAGCCATGNCCAGAATTGAGGAGAAGTTCCAAACGAATGATGAT
rJMFF042E05+ TTCTAGTGACAGAGAGAAGCCATGGCCAGAATTGAGGAGAAGTTCCAAA-GAATGATGAT
rJMFF045J06+ TTTTAGTGACAGAGAGAAGCCATGGCCAGAATTGAGGAGAAGTTCCAAA-GAATGATGAT
                      ____________________________________________________________
consensus TTCTAGTGACAGAGAGAAGCCATGGCCAGAATTGAGGAGAAGTTCCAAA-GAATGATGAT
 
. : . : . : . : . : . :
rJMFF018K01+ ANCTGGTGCGACATATTTTATTTT
rJMFF042E05+ AACTGGTGTGACATATTTTATTTTAGGGTTTATTCTACTTTTGATCTTGTATTATTTCTA
rJMFF045J06+ AACTGGTGTGACATATTTTATTTTAGGGTTTATTCTACTTTTGATCTTGTATTATTTCTA
                      ____________________________________________________________
consensus AACTGGTGTGACATATTTTATTTTAGGGTTTATTCTACTTTTGATCTTGTATTATTTCTA
 
. : . : . : . : . : . :
rJMFF042E05+ TTTATGACATGTGATTACTTTGTGCTTGTGAG
rJMFF045J06+ TTTATGACATGTGATTACTTTGTGCTTGTGAGAAAAAAATGTTTTAGTTTTAGTTATTTT
                      ____________________________________________________________
consensus TTTATGACATGTGATTACTTTGTGCTTGTGAGAAAAAAATGTTTTAGTTTTAGTTATTTT