Previous Contig 010553:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004I22Sequence734010553 (4)gb:AP006727_18627076e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P064
JMFF045I23Sequence645003274 (2)pir|T49091|T490917e-24gamma response I protein - Arabidopsis thaliana>gb:ATF4F15_1550678 Arabidopsis t596010553 (4)gb:AP006727_18627073e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P064
JMFN035J20Sequence446010553 (4)gb:AP006727_18627071e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P064
JMFS115G06Sequence614010553 (4)gb:AP006727_18627076e-67Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P064

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS115G06- TCTCAAAGGTCATATCAGCAACGCTCGAATTATCAAATTCCAGCATC
                      ____________________________________________________________
consensus TCTCAAAGGTCATATCAGCAACGCTCGAATTATCAAATTCCAGCATC
 
. : . : . : . : . : . :
JMFS115G06- AGCTTTGTATGGTACAGCAGATGCTTCTAGAGAGGATGCATATACTGGAAGATATGGTGA
                      ____________________________________________________________
consensus AGCTTTGTATGGTACAGCAGATGCTTCTAGAGAGGATGCATATACTGGAAGATATGGTGA
 
. : . : . : . : . : . :
JMFS115G06- ACCTAATCCTCCAACAGCAGCAGATCCAATAGCAATGATGGAGTTTTACATGAAGAAGGC
JMFN035J20- AGGC
rJMFF004I22+ CCAACAGCAGCAGATCCAATAGTAATGATGGAGTTTTACATGAAGAAGGC
                      ____________________________________________________________
consensus ACCTAATCCTCCAACAGCAGCAGATCCAATAGTAATGATGGAGTTTTACATGAAGAAGGC
 
. : . : . : . : . : . :
JMFS115G06- TGCACAAGAAGAGAAATTGAGGCCCCTAAAGTCATCAAAGGATGAGATGCCTCCACCCCC
JMFN035J20- TGCACAAGAAGAGAAATTGAGGCCCCTAAAGTCATCAAAGGATGAGATGCCTCCACCCCC
rJMFF004I22+ TGCACAAGAAGAGAAATTGAGGCCCCTAAAGTCATCAAAGGATGAGATGCCTCCACCCCC
                      ____________________________________________________________
consensus TGCACAAGAAGAGAAATTGAGGCCCCTAAAGTCATCAAAGGATGAGATGCCTCCACCCCC
 
. : . : . : . : . : . :
JMFS115G06- TTCCCTTCAAGTTGCTGCTTCTTCTGGCAAGAAAGGGCATCATATGGGAGACTATATCCC
JMFN035J20- TTCCCTTCAAGTTGCTGCTTCTTCTGGCAAGAAAGGGCATCATATGGGAGACTATATCCC
rJMFF004I22+ TTCCCTTCAAGTTGCTGCTTCTTCTGGCAAGAAAGGGCATCATATGGGAGACTATATCCC
                      ____________________________________________________________
consensus TTCCCTTCAAGTTGCTGCTTCTTCTGGCAAGAAAGGGCATCATATGGGAGACTATATCCC
 
. : . : . : . : . : . :
JMFS115G06- ACCCGAAGAGCTTGCAAAGTTCATGGCTAACTGCAATGATGCTGCTGCGCAGAAAGCAAC
JMFN035J20- ACCCGAAGAGCTTGCAAAGTTCATGGCTAACTGCAATGATGCTGCTGCGCAGAAAGCAAC
rJMFF004I22+ ACCCGAAGAGCTTGCAAAGTTCATGGCTAACTGCAATGATGCTGCTGCGCAGAAAGCAAC
rJMFF045I23+ GAAGAGCTTGCAAAGTTCATGGCTAACTGCAATGATGCTGCTGCGCAGAAAGCAAC
                      ____________________________________________________________
consensus ACCCGAAGAGCTTGCAAAGTTCATGGCTAACTGCAATGATGCTGCTGCGCAGAAAGCAAC
 
. : . : . : . : . : . :
JMFS115G06- CAAGGAGATTGCTGAGAGGAACAAAATTCAGGCCAATAATATCGGTCACAAACTGTTATC
JMFN035J20- CAAGGAGATTGCTGAGAGGAACAAAATTCAGGCCAATAATATCGGTCACAAACTGTTATC
rJMFF004I22+ CAAGGAGATTGCTGAGAGGAACAAAATTCAGGCCAATAATATCGGTCACAAACTGTTATC
rJMFF045I23+ CAAGGAGATTGCTGAGAGGAACAAAATTCAGGCCAATAATATCGGTCACAAACTGTTATC
                      ____________________________________________________________
consensus CAAGGAGATTGCTGAGAGGAACAAAATTCAGGCCAATAATATCGGTCACAAACTGTTATC
 
. : . : . : . : . : . :
JMFS115G06- AAAAATGGGATGGAGAGAAGGTGAAGGTCTGGGAAGCTCTAGAAGCGGTATTGCTGATCC
JMFN035J20- AAAAATGGGATGGAGAGAAGGTGAAGGTCTGGGCAGCTCTAGAAGCGGTATTGCTGATCC
rJMFF004I22+ AAAAATGGGATGGAGAGAAGGTGAAGGTCTGGGAAGCTCTAGAAGCGGTATTGCTGATCC
rJMFF045I23+ AAAAATGGGATGGAGAGAAGGTGAAGGTCTGGGAAGCTCTAGAAGCGGTATTGCTGATCC
                      ____________________________________________________________
consensus AAAAATGGGATGGAGAGAAGGTGAAGGTCTGGGAAGCTCTAGAAGCGGTATTGCTGATCC
 
. : . : . : . : . : . :
JMFS115G06- AATTACAGCAGGTGAAGTAAAGTCAAACAACCTCGGGGTTGGTGCTCATAATCCCGGGGA
JMFN035J20- AATTACAGCAGGTGAAGTAAAGTCAAACAACCTCGGGGTTGGTGCTCATAATCCCGGGGA
rJMFF004I22+ AATTACAGCAGGTGAAGTAAAGTCAAACAACCTCGGGGTTGGTGCTCATAATCCCGGGGA
rJMFF045I23+ AATTACAGCAGGTGAAGTAAAGTCAAACAACCTCGGGGTTGGTGCTCATAATCCCGGGGA
                      ____________________________________________________________
consensus AATTACAGCAGGTGAAGTAAAGTCAAACAACCTCGGGGTTGGTGCTCATAATCCCGGGGA
 
. : . : . : . : . : . :
JMFS115G06- GGTCACTCCAGAAGACGATATCTATGAGCAGTACAAGAAGCGGATGATGCTGGGCTATCG
JMFN035J20- GGTCACTCCAGAAGACGATATCTATGAGCAGTACAAGAAGCGGATGATGCTGGGCTATCC
rJMFF004I22+ GGTCACTCCAGAAGACGATATCTATGAGCAGTACAAGAAGCGGATGATGCTGGGCTATCG
rJMFF045I23+ GGTCACTCCAGAAGACGATATCTATGAGCAGTACAAGAAGCGGATGATGCTGGGCTATCG
                      ____________________________________________________________
consensus GGTCACTCCAGAAGACGATATCTATGAGCAGTACAAGAAGCGGATGATGCTGGGCTATCG
 
. : . : . : . : . : . :
JMFS115G06- ATACAGGCCAAATCCTTTGAAC
JMFN035J20- ATACAGGCCAAATCCTTTGAAC
rJMFF004I22+ ATACAGGCCAAATCCTTTGAACAATCCTCGGAAATCGTATTACTGAGACGATTTCTTGAT
rJMFF045I23+ ATACAGGCCAAATCCTTTGAACAATCCTCGGAAATCGTATTACTGAGACGATTTCTTGAT
                      ____________________________________________________________
consensus ATACAGGCCAAATCCTTTGAACAATCCTCGGAAATCGTATTACTGAGACGATTTCTTGAT
 
. : . : . : . : . : . :
rJMFF004I22+ CTCTCCAATCGTATCTGCCATGGAATGCTGTAATAACACCTCTGCATCAAAGCACCCCAG
rJMFF045I23+ CTCTCCAATCGTATCTGCCATGGAATGCTGTAATAACACCTCTGCATCAAAGCACCCCAG
                      ____________________________________________________________
consensus CTCTCCAATCGTATCTGCCATGGAATGCTGTAATAACACCTCTGCATCAAAGCACCCCAG
 
. : . : . : . : . : . :
rJMFF004I22+ CTCTCGGTCTATATTGTTTTTCAGGAAAAGAATCCACTTTTAAAGTTTGTGTCCTTACAG
rJMFF045I23+ CTCTCGGTCTATATTGTTTTTCAGGAAAAGAATCCACTTTTAAAGTTTGTGTCCTTACAG
                      ____________________________________________________________
consensus CTCTCGGTCTATATTGTTTTTCAGGAAAAGAATCCACTTTTAAAGTTTGTGTCCTTACAG
 
. : . : . : . : . : . :
rJMFF004I22+ ATTGAATGACTTCCCTGCAAATTTGTATTAAGTGTTGAAATTAAACTTGCTTGCTTATTT
rJMFF045I23+ ATTGAATGACTTCCCTGCAAATTTGTATTAAGTGTTGAAATTAAACTTGCTTGCTTATTT
                      ____________________________________________________________
consensus ATTGAATGACTTCCCTGCAAATTTGTATTAAGTGTTGAAATTAAACTTGCTTGCTTATTT
 
. : . : . : . : . : . :
rJMFF004I22+ ATCATAATGGCCCATCTCCAGGTC
rJMFF045I23+ ATCATAATGGCCCATCTCCAGGTCATCTTCTTAATGAATGTCTTATCTCATTCCTTGCCC
                      ____________________________________________________________
consensus ATCATAATGGCCCATCTCCAGGTCATCTTCTTAATGAATGTCTTATCTCATTCCTTGCCC