Previous Contig 010551:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045I20Sequence644010551 (2)gb:AP003218_18254329e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN634010551 (2)gb:AP003284_18272344e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045I20- GCTTCTCTCTTTTCTCCTAAAATCCTGAAGACCTAAA
                      ____________________________________________________________
consensus GCTTCTCTCTTTTCTCCTAAAATCCTGAAGACCTAAA
 
. : . : . : . : . : . :
JMFF045I20- CCTACCTCCATGACCATGGCTATGGAAATCGGCATTGTTGAATACGTTGACCAATCCCCC
                      ____________________________________________________________
consensus CCTACCTCCATGACCATGGCTATGGAAATCGGCATTGTTGAATACGTTGACCAATCCCCC
 
. : . : . : . : . : . :
JMFF045I20- GATCTTTTTAACGTTCAATTCCACAGAGAGTGTATCAAAACCTTGGTCACCCATGAAGCC
                      ____________________________________________________________
consensus GATCTTTTTAACGTTCAATTCCACAGAGAGTGTATCAAAACCTTGGTCACCCATGAAGCC
 
. : . : . : . : . : . :
JMFF045I20- AGAAAGGTCGATGAGTGGATCTCTGAGGTGGAGGCCATCCATCGCCACCGTCTGAACCAC
                      ____________________________________________________________
consensus AGAAAGGTCGATGAGTGGATCTCTGAGGTGGAGGCCATCCATCGCCACCGTCTGAACCAC
 
. : . : . : . : . : . :
JMFF045I20- CTGATCGTCGGCCTCGACGTAGAGTGGCGCCCCAATTTCTCCAAGGCGCAGCAGAACCCG
rJMFF045I20+ GCGCCCCAATTTCTCCAAGGCGCAGCAGAACCCG
                      ____________________________________________________________
consensus CTGATCGTCGGCCTCGACGTAGAGTGGCGCCCCAATTTCTCCAAGGCGCAGCAGAACCCG
 
. : . : . : . : . : . :
JMFF045I20- GTGGCGACTCTCCAGCTCTGCGTGGGGCGCCGCTGCCTCGTATTCCAACTCCTCTACTGC
rJMFF045I20+ GTGGCGACTCTCCAGCTCTGCGTGGGGCGCCGCTGCCTCGTATTCCAACTCCTCTACTGC
                      ____________________________________________________________
consensus GTGGCGACTCTCCAGCTCTGCGTGGGGCGCCGCTGCCTCGTATTCCAACTCCTCTACTGC
 
. : . : . : . : . : . :
JMFF045I20- AGCCGCATCCCGGACAAGCTCGTCAGCTTCCTCGCGAACCCCGCCTACACCTTCGTCGGG
rJMFF045I20+ AGCCGCATCCCGGACAAGCTCGTCAGCTTCCTCGCGAACCCCGCCTACACCTTCGTCGGG
                      ____________________________________________________________
consensus AGCCGCATCCCGGACAAGCTCGTCAGCTTCCTCGCGAACCCCGCCTACACCTTCGTCGGG
 
. : . : . : . : . : . :
JMFF045I20- GTCGCGATCGACGGCGACGTGGAGAAGCTGGTGGAAGACTACAATCTGAGTGTGAGGAAG
rJMFF045I20+ GTCGCGATCGACGGCGACGTGGAGAAGCTGGTGGAAGACTACAATCTGAGTGTGAGGAAG
                      ____________________________________________________________
consensus GTCGCGATCGACGGCGACGTGGAGAAGCTGGTGGAAGACTACAATCTGAGTGTGAGGAAG
 
. : . : . : . : . : . :
JMFF045I20- GCCGTGGATTTGCGCCCCTAGCTGTGCGGCAGTCCAACGATTCGTCTCTGAAGAACGTTG
rJMFF045I20+ GCCGTGGATTTGCGCCCCTAGCTGTGCGGCAGTCCAACGATTCGTCTCTGAAGAACGTTG
                      ____________________________________________________________
consensus GCCGTGGATTTGCGCCCCTAGCTGTGCGGCAGTCCAACGATTCGTCTCTGAAGAACGTTG
 
. : . : . : . : . : . :
JMFF045I20- GATTGAAGGATCTGGTGAGGATTTATCTGGGGGCGGAGATGGTGAAGCCGAAACGGGTGA
rJMFF045I20+ GATTGAAGGATCTGGTGAGGATTTATCTGGGGGCGGAGATGGTGAAGCCGAAACGGGTGA
                      ____________________________________________________________
consensus GATTGAAGGATCTGGTGAGGATTTATCTGGGGGCGGAGATGGTGAAGCCGAAACGGGTGA
 
. : . : . : . : . : . :
JMFF045I20- CGATGGGGAGGTGGGAT-AAGAGTTGCT-ACCACAGAGCAGATTCAGTATGCGTGCATTG
rJMFF045I20+ CGATGGGGAGGTGGGATAAAGAGTTGCTAACCACAGAGCAGATTCAGTATGCGTGCATTG
                      ____________________________________________________________
consensus CGATGGGGAGGTGGGATAAAGAGTTGCTAACCACAGAGCAGATTCAGTATGCGTGCATTG
 
. : . : . : . : . : . :
JMFF045I20- ATGCTTTTG
rJMFF045I20+ ATGCTTTTGTGTGTTTTGAAATTGGCAGGATTTTGAATGCTTCTTCTTCTGCTCATTAGA
                      ____________________________________________________________
consensus ATGCTTTTGTGTGTTTTGAAATTGGCAGGATTTTGAATGCTTCTTCTTCTGCTCATTAGA
 
. : . : . : . : . : . :
rJMFF045I20+ GTAATGACTAATTCACTAGACTATATATGAGGACTGCTTTATTTTGCTAATGCCAACTGC
                      ____________________________________________________________
consensus GTAATGACTAATTCACTAGACTATATATGAGGACTGCTTTATTTTGCTAATGCCAACTGC
 
. : . : . : . : . : . :
rJMFF045I20+ AGCTGTTATATTTGATTCTGTATTTCTGCAACTATGTAGTAGGAGGAGTGTTATTAAGAT
                      ____________________________________________________________
consensus AGCTGTTATATTTGATTCTGTATTTCTGCAACTATGTAGTAGGAGGAGTGTTATTAAGAT
 
. : . : . : . : . : . :
rJMFF045I20+ GATCAATTAATTAGTATATTGGGGATTATCTCTAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus GATCAATTAATTAGTATATTGGGGATTATCTCTAAAAAAAAAAAAAAAACTCTCCAGGGT