Previous Contig 010548:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007H07Sequence506000379 (4)gb:AY346458_16010366e-41Solanum chacoense MYST-type acetyltransferase mRNA, partial cds.707010548 (4)gb:AY346458_16010361e-86Solanum chacoense MYST-type acetyltransferase mRNA, partial cds.
JMFF045I12Sequence635000379 (4)gb:AY346458_16010362e-57Solanum chacoense MYST-type acetyltransferase mRNA, partial cds.632010548 (4)gb:AY346458_16010362e-66Solanum chacoense MYST-type acetyltransferase mRNA, partial cds.
JMSF037D20Sequence694000379 (4)gb:AY346458_16010361e-63Solanum chacoense MYST-type acetyltransferase mRNA, partial cds.750010548 (4)gb:AY346458_1601036e-103Solanum chacoense MYST-type acetyltransferase mRNA, partial cds.
JMSF049E17Sequence664010548 (4)gb:AP004009_18363000.003Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ13112024355gb:AB010070_15108855e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK20.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049E17- GGGAGGACCAGCAGAGCAGACACTCTACTCCTCTTTCGCCTACTGCCTCCA
                      ____________________________________________________________
consensus GGGAGGACCAGCAGAGCAGACACTCTACTCCTCTTTCGCCTACTGCCTCCA
 
. : . : . : . : . : . :
JMSF049E17- CGCCCCAGCCACCACTCCATCACTCCATTAGAACTCTTCATCGAATATTTGGAGATTCGC
                      ____________________________________________________________
consensus CGCCCCAGCCACCACTCCATCACTCCATTAGAACTCTTCATCGAATATTTGGAGATTCGC
 
. : . : . : . : . : . :
JMSF049E17- GGCCCATTACTCCACACGCGCCTCCACCGACCACCGTTGTCCGGCTACTCTCCTCCATGG
                      ____________________________________________________________
consensus GGCCCATTACTCCACACGCGCCTCCACCGACCACCGTTGTCCGGCTACTCTCCTCCATGG
 
. : . : . : . : . : . :
JMSF049E17- CTCCGTCCGTTCACGGTTCACCATTCGTCCATTCGTCCACCATTATAGATTTATAGCCTC
                      ____________________________________________________________
consensus CTCCGTCCGTTCACGGTTCACCATTCGTCCATTCGTCCACCATTATAGATTTATAGCCTC
 
. : . : . : . : . : . :
JMSF049E17- CGGTAGTCAGGTTCGAACCAATCTTCATTATTCTTCAACTTGATTCTTTTAATTAGTTTG
                      ____________________________________________________________
consensus CGGTAGTCAGGTTCGAACCAATCTTCATTATTCTTCAACTTGATTCTTTTAATTAGTTTG
 
. : . : . : . : . : . :
JMSF049E17- CCACTTTGCCCTAATGGCTAATTCCATAAAAATGATGATTGATAAATCCCTAATTCCCTA
                      ____________________________________________________________
consensus CCACTTTGCCCTAATGGCTAATTCCATAAAAATGATGATTGATAAATCCCTAATTCCCTA
 
. : . : . : . : . : . :
JMSF049E17- AATTTTCAATTAGTTTGCCCTACTAATGTCTCCGTCCGTTCACCGTGAATGTGATGATCG
rJMSF037D20+ GTGAATGTGATGATCG
rJMFF007H07+ GATGATNG
                      ____________________________________________________________
consensus AATTTTCAATTAGTTTGCCCTACTAATGTCTCCGTCCGTTCACCGTGAATGTGATGATCG
 
. : . : . : . : . : . :
JMSF049E17- AGGGTGCCATATGGTTGGCTATTTTTCTAAGG
rJMSF037D20+ AGGGTGCCATATGGTTGGCTATTTTTCTAAGGAAAAACATTCGGAAGAATCTTACAATTT
rJMFF007H07+ AGGGTGCCATATGGTTGGCTATTTTTCTAAGGAAAAACATTCGGAAGAATCTTACAATTT
                      ____________________________________________________________
consensus AGGGTGCCATATGGTTGGCTATTTTTCTAAGGAAAAACATTCGGAAGAATCTTACAATTT
 
. : . : . : . : . : . :
rJMSF037D20+ GGCCTGTATCCTGACTCTTCCACCTTATCAGAGAAAAGGCTATGGGAAATTCCTAATTGC
rJMFF007H07+ GGCNTGTATCCTGACTCTTCCACCTTATCAGAGAAAAGGCTATGGGAAATTCCTAATTGC
rJMFF045I12+ TCAGAGAAAAGGCTATGGGAAATTCCTAATTGC
                      ____________________________________________________________
consensus GGCCTGTATCCTGACTCTTCCACCTTATCAGAGAAAAGGCTATGGGAAATTCCTAATTGC
 
. : . : . : . : . : . :
rJMSF037D20+ ATTTTCATATGAACTTTCTAAGAAAGAAGGTAAAGTGGGCACTCCAGAAAGACCTCTTTC
rJMFF007H07+ ATTTTCATATGAACTTTCTAAGAAAGAAGGTAAAGTGGGCACTCCAGAAAGACCTCTTTC
rJMFF045I12+ ATTTTCATATGAACTTTCTAAGAAAGAAGGTAAAGTGGGCACTCCAGAAAGACCTCTTTC
                      ____________________________________________________________
consensus ATTTTCATATGAACTTTCTAAGAAAGAAGGTAAAGTGGGCACTCCAGAAAGACCTCTTTC
 
. : . : . : . : . : . :
rJMSF037D20+ TGACTTAGGTATGCTAAGCTACCGGGGTTATTGGACTCGTGTTTTACTAGATATATTGAA
rJMFF007H07+ TGACTTAGGTATGCTAAGCTACCGGGGTTATTGGACTCGTGTTTTACTAGATATATTGAA
rJMFF045I12+ TGACTTAGGTATGCTAAGCTACCGGGGTTATTGGACTCGTGTTTTACTAGATATATTGAA
                      ____________________________________________________________
consensus TGACTTAGGTATGCTAAGCTACCGGGGTTATTGGACTCGTGTTTTACTAGATATATTGAA
 
. : . : . : . : . : . :
rJMSF037D20+ AAAGCACAAGGGCAACATTTCTATCAAGGAGCTGAGTGATATGACTGCAATCAAGGCAGA
rJMFF007H07+ AAAGCACAAGGGCAACATTTCTATCAAGGAGCTGAGTGATATGACTGCAATCAAGGCAGA
rJMFF045I12+ AAAGCACAAGGGCAACATTTCTATCAAGGAGCTGAGTGATATGACTGCAATCAAGGCAGA
                      ____________________________________________________________
consensus AAAGCACAAGGGCAACATTTCTATCAAGGAGCTGAGTGATATGACTGCAATCAAGGCAGA
 
. : . : . : . : . : . :
rJMSF037D20+ AGACATTCTAAGCACCCTTCAGGCCTTGGAGCTAATTCAGTACCGGAAAGGGCAACATGT
rJMFF007H07+ AGACATTCTAAGCACCCTTCAGGCCTTGGAGCTAATTCAGTACCGGAAAGGGCAACATGT
rJMFF045I12+ AGACATTCTAAGCACCCTTCAGGCCTTGGAGCTAATTCAGTACCGGAAAGGGCAACATGT
                      ____________________________________________________________
consensus AGACATTCTAAGCACCCTTCAGGCCTTGGAGCTAATTCAGTACCGGAAAGGGCAACATGT
 
. : . : . : . : . : . :
rJMSF037D20+ CATCTGTGCTGATCCCAAGGTGTTGGATCGTCATCTAAAAGCTGCTGGCCGAGGTGGTCT
rJMFF007H07+ CATCTGTGCTGATCCCAAGGTGTTGGATCGTCATCTAAAAGCTGCTGGCCGAGGTGGTCT
rJMFF045I12+ CATCTGTGCTGATCCCAAGGTGTTGGATCGTCATCTAAAAGCTGCTGGCCGAGGTGGTCT
                      ____________________________________________________________
consensus CATCTGTGCTGATCCCAAGGTGTTGGATCGTCATCTAAAAGCTGCTGGCCGAGGTGGTCT
 
. : . : . : . : . : . :
rJMSF037D20+ GGAAGTGGATGTTAGCAAATTGATATGGACTCCTTACAAGGAGCAAAGCTAATTTTAAAC
rJMFF007H07+ GGAAGTGGATGTTAGCAAATTGATATGGACTCCTTACAAGGAGCAAAGCTAATTTTAAAC
rJMFF045I12+ GGAAGTGGATGTTAGCAAATTGATATGGACTCCTTACAAGGAGCAAAGCTAATTTTAAAC
                      ____________________________________________________________
consensus GGAAGTGGATGTTAGCAAATTGATATGGACTCCTTACAAGGAGCAAAGCTAATTTTAAAC
 
. : . : . : . : . : . :
rJMSF037D20+ TACCTTTCATCCTTTTACAGCTCCCTCTCTCCCTCCCTTGCCCACCAAGGTGGGATATGT
rJMFF007H07+ TACCTTTCATCCTTTTACAGCTCCCTCTCTCCCTCCCTTGCCCACCAAGGTGGGATATGT
rJMFF045I12+ TACCTTTCATCCTTTTACAGCTCCCTCTCTCCCTCCCTTGCCCACCAAGGTGGGATATGT
                      ____________________________________________________________
consensus TACCTTTCATCCTTTTACAGCTCCCTCTCTCCCTCCCTTGCCCACCAAGGTGGGATATGT
 
. : . : . : . : . : . :
rJMSF037D20+ ACAAAAAATCCAGGTAATTAACATTTGGTCTTTACTCTTTAGGTCAACAACAATGGTAGG
rJMFF007H07+ ACAAAAAATCCAGGTAATTAACATTTGGTCTTTACTCTTTAGGTCAACAACAATGGTAGG
rJMFF045I12+ ACAAAAAATCCAGGTAATTAACATTTGGTCTTTACTCTTTAGGTCAACAACAATGGTAGG
                      ____________________________________________________________
consensus ACAAAAAATCCAGGTAATTAACATTTGGTCTTTACTCTTTAGGTCAACAACAATGGTAGG
 
. : . : . : . : . : . :
rJMSF037D20+ TTTAACAGAATGCCAATGCCTTGTACCAAAGATATACCGCCGTGTACTGTATGTAATGCT
rJMFF007H07+ TTTAACAGAATGCCAATGCCTTGTACCAAAGATATA-CGCCGTGTACTGTATGTAATGCT
rJMFF045I12+ TTTAACAGAATGCCAATGCCTTGTACCAAAGATATA-CGCCGTGTACTGTATGTAATGCT
                      ____________________________________________________________
consensus TTTAACAGAATGCCAATGCCTTGTACCAAAGATATA-CGCCGTGTACTGTATGTAATGCT
 
. : . : . : . : . : . :
rJMFF007H07+ TGACTATGGTATATATTCTGTTGAATGA
rJMFF045I12+ TGACTATGGTATATATTCTGTTGAATGAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGACTATGGTATATATTCTGTTGAATGAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGT