Previous Contig 010546:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001G15Sequence653010546 (89)gb:AB019427_15142775e-49Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF001O11Sequence515000858 (51)gb:AY550990_16133189e-77Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.763010546 (89)gb:TOBBY2A_17253671e-60Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF005E14Sequence209000858 (51)gb:AF464925_18020281e-15Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.699010546 (89)gb:TOBBY2A_17253672e-62Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF005M12Sequence451000858 (51)gb:AF464925_18020288e-64Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.725010546 (89)gb:TOBBY2A_17253671e-66Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF006H20Sequence592010546 (89)gb:AY550990_16133187e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.764010999 (31)gb:TOBBY2A_17253671e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF006J11Sequence562000858 (51)gb:AF181492_17748525e-89Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.768010546 (89)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF007K05Sequence624000858 (51)gb:AY550990_16133182e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.777010546 (89)gb:TOBBY2A_17253672e-85Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF007K06Sequence593010546 (89)gb:AY550990_16133187e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.740010999 (31)gb:TOBBY2A_17253671e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF008N04Sequence547010546 (89)gb:AY550990_16133181e-90Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.744010999 (31)gb:TOBBY2A_17253675e-78Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF008N05Sequence583000858 (51)gb:AY550990_16133181e-90Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.782010546 (89)gb:TOBBY2A_17253673e-87Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF008N15Sequence597010546 (89)gb:AY550990_1613318e-100Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.781010999 (31)gb:TOBBY2A_17253671e-86Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF010J23Sequence546000858 (51)gb:AF181492_17748523e-84Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.764010546 (89)gb:TOBBY2A_17253672e-69Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF012F19Sequence442000858 (51)gb:AF464925_18020281e-62Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.677010546 (89)gb:TOBBY2A_17253674e-66Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF013E05Sequence572000858 (51)gb:AF181492_17748525e-89Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.753010546 (89)gb:TOBBY2A_17253679e-68Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF013G22Sequence566010546 (89)gb:AY550990_16133184e-94Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.781010999 (31)gb:TOBBY2A_17253673e-87Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF014A22Sequence571000858 (51)gb:AF181492_17748522e-88Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.776010546 (89)gb:TOBBY2A_17253677e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF015E05Sequence516000858 (51)gb:AY550990_16133189e-78Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.769010546 (89)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF015P08Sequence621000858 (51)gb:AY550990_16133188e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.347010546 (89)
JMFF017G05Sequence255010546 (89)
JMFF019I17Sequence548010546 (89)gb:AY550990_16133181e-90Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.743010999 (31)gb:TOBBY2A_17253671e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF019M03Sequence518010546 (89)gb:AF181492_17748527e-85Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.740010999 (31)gb:TOBBY2A_17253674e-82Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF022E02Sequence508000858 (51)gb:AY550990_16133185e-76Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.711010546 (89)gb:TOBBY2A_17253672e-73Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF022L07Sequence549010546 (89)gb:AY550990_16133182e-85Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.680001399 (13)gb:AJ844002_18146945e-29Plantago major mRNA for copper chaperone (cch1 gene).
JMFF023G06Sequence428010546 (89)gb:AF464925_18020289e-66Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.719010999 (31)gb:TOBBY2A_17253671e-71Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF023L05Sequence483010546 (89)gb:AY550990_16133182e-77Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.734010999 (31)gb:TOBBY2A_17253671e-82Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF023N07Sequence428010546 (89)gb:AF464925_18020289e-66Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.268010999 (31)
JMFF023P24Sequence464000858 (51)gb:AF464925_18020285e-67Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.767010546 (89)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF024K08Sequence518000858 (51)gb:AF360167_17911236e-73Arabidopsis thaliana putative translation elongation factor eEF-1 alpha chain A4767010546 (89)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF024O15Sequence520000858 (51)sp|O49169|EF1A_MANES7e-74Elongation factor 1-alpha (EF-1-alpha).>gb:AF041463_1763462 Manihot esculenta el765010546 (89)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF027H04Sequence516010546 (89)gb:AF181492_17748527e-85Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.728010999 (31)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF029I16Sequence592010546 (89)gb:AY550990_16133187e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.739010999 (31)gb:TOBBY2A_17253671e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF030E04Sequence535010546 (89)gb:AF181492_17748523e-88Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.170010999 (31)
JMFF030E05Sequence431010546 (89)gb:TOBBY2A_17253677e-16Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF031D01Sequence512000858 (51)gb:AY550990_16133188e-78Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.661010546 (89)gb:AB019427_15142771e-54Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF031D23Sequence577000858 (51)gb:AY550990_16133187e-90Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.781010546 (89)gb:TOBBY2A_17253678e-87Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF032L02Sequence520000858 (51)gb:AY550990_16133183e-77Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.698010546 (89)gb:TOBBY2A_17253672e-62Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF032O04Sequence545000858 (51)gb:AF181492_17748524e-84Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.766010546 (89)gb:TOBBY2A_17253675e-70Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF034J15Sequence733010546 (89)gb:TOBBY2A_1725367e-104Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF034J19Sequence582000858 (51)gb:AY550990_16133181e-90Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.701010546 (89)gb:TOBBY2A_17253671e-73Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF035J23Sequence552010546 (89)gb:AY550990_16133189e-92Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.690010999 (31)gb:TOBBY2A_17253679e-68Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF035N22Sequence574000858 (51)gb:AF181492_17748525e-89Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.753010546 (89)gb:TOBBY2A_17253673e-97Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF036D17Sequence724010546 (89)gb:TOBBY2A_17253674e-65Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF036K23Sequence577000858 (51)gb:AY550990_16133181e-90Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.708010546 (89)gb:TOBBY2A_1725367e-108Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF036O03Sequence575010546 (89)gb:AY550990_16133187e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.715010999 (31)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF037H15Sequence512000858 (51)gb:AY550990_16133183e-76Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.727010546 (89)gb:TOBBY2A_17253671e-67Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF037J08Sequence552010546 (89)gb:AY550990_16133183e-91Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.363010999 (31)gb:AF281361_17829421e-18Saccharum officinarum elongation factor mRNA, complete cds.
JMFF037O10Sequence548010546 (89)gb:AY550990_16133183e-91Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.771010999 (31)gb:TOBBY2A_1725367e-102Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF039C05Sequence379010546 (89)gb:AF464925_18020283e-56Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.664010999 (31)gb:TOBBY2A_17253671e-62Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF039E20Sequence697010546 (89)gb:TOBBY2A_17253672e-62Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF040D18Sequence598000858 (51)gb:AY550990_16133188e-95Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.768010546 (89)gb:TOBBY2A_17253673e-74Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF041G03Sequence650010546 (89)gb:AB019427_1514277e-111Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.502010999 (31)gb:AB019427_15142771e-30Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF041J02Sequence660010546 (89)gb:AB019427_1514277e-111Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.620010999 (31)gb:AB019427_15142771e-48Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF042A09Sequence643000858 (51)gb:AY550990_1613318e-103Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.617010546 (89)gb:AB019427_15142775e-43Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF044G13Sequence640000858 (51)gb:AY550990_1613318e-101Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.387010546 (89)gb:AB019427_15142774e-34Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF044K21Sequence621000858 (51)gb:AY550990_16133188e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.637010546 (89)gb:TOBBY2A_17253671e-81Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF044L09Sequence640010546 (89)gb:AB019427_1514277e-110Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.592010999 (31)gb:AB019427_15142773e-50Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF045I06Sequence635000858 (51)gb:AY550990_1613318e-101Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.642010546 (89)gb:AB019427_15142771e-38Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF046D21Sequence545000858 (51)gb:AF181492_17748521e-82Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.457010546 (89)gb:TOBBY2A_17253678e-06Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF046F19Sequence370015028332010546 (89)
JMFF046G09Sequence616000858 (51)gb:AY550990_16133182e-98Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.628010546 (89)gb:AB019427_15142772e-49Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF046N23Sequence581010546 (89)sp|O49169|EF1A_MANES3e-92Elongation factor 1-alpha (EF-1-alpha).>gb:AF041463_1763462 Manihot esculenta el517021770gb:TOBBY2A_17253672e-19Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF046O24Sequence589000858 (51)gb:AF181492_17748521e-87Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.249010546 (89)gb:TOBBY2A_17253672e-06Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF047K13Sequence493000858 (51)gb:AY550990_16133189e-71Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.405010546 (89)
JMFF047K20Sequence444000858 (51)gb:AF464925_18020289e-63Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.454010546 (89)gb:AB019427_15142773e-44Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF049N21Sequence621000858 (51)sp|O49169|EF1A_MANES3e-93Elongation factor 1-alpha (EF-1-alpha).>gb:AF041463_1763462 Manihot esculenta el602010546 (89)gb:AB019427_15142779e-39Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF050H22Sequence631010546 (89)gb:ZMU76259_1732225e-104Zea mays elongation factor 1-alpha (EF1-A) mRNA, complete cds.623010999 (31)gb:AB019427_15142772e-48Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF050J22Sequence568010546 (89)gb:AY550990_16133182e-88Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.501010999 (31)gb:TOBBY2A_17253675e-24Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFN003B17Sequence626010546 (89)gb:TOBBY2A_1725367e-103Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFN014H03Sequence533010546 (89)gb:TOBBY2A_17253672e-26Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFN020B21Sequence548010546 (89)gb:AB019427_15142773e-29Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFN035C04Sequence617010546 (89)gb:AF331850_1787161e-112Saccharum hybrid cultivar CP72-2086 elongation factor 1 alpha (SEF1a) mRNA, part
JMFN043O23Sequence604010546 (89)gb:AF331850_1787161e-109Saccharum hybrid cultivar CP72-2086 elongation factor 1 alpha (SEF1a) mRNA, part
JMFS040F08Sequence626010546 (89)sp|O49169|EF1A_MANESe-113Elongation factor 1-alpha (EF-1-alpha).>gb:AF041463_1763462 Manihot esculenta el
JMFS066E08Sequence595010546 (89)gb:AB019427_1514277e-109Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFS082G04Sequence619010546 (89)gb:AB019427_1514277e-108Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMSF001E08Sequence337010546 (89)gb:AF464925_18020283e-48Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.752010999 (31)gb:TOBBY2A_17253671e-77Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF007A14Sequence213010546 (89)gb:AF464925_18020285e-22Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.749010999 (31)gb:TOBBY2A_17253673e-87Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF014C03Sequence281000858 (51)gb:AF464925_18020284e-30Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.813010546 (89)gb:TOBBY2A_17253672e-78Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF016F05Sequence550010546 (89)gb:AY550990_16133183e-91Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.780010999 (31)gb:TOBBY2A_17253672e-76Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF021E21Sequence596010546 (89)gb:AY550990_16133182e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.740010999 (31)gb:TOBBY2A_17253674e-82Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF023I24Sequence683010546 (89)gb:AY550990_1613318e-127Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.771010546 (89)gb:TOBBY2A_17253675e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF029C20Sequence674000858 (51)gb:AB019427_1514277e-109Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.773010546 (89)gb:TOBBY2A_17253675e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF037B20Sequence696000858 (51)gb:AB019427_1514277e-114Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.691010546 (89)gb:TOBBY2A_17253672e-71Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF038J03Sequence626000858 (51)gb:AY550990_16133182e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.962010546 (89)gb:TOBBY2A_1725367e-152Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF038O22Sequence631000858 (51)gb:AY550990_1613318e-100Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.903010546 (89)gb:TOBBY2A_1725367e-134Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF046J12Sequence736010546 (89)gb:AB019427_1514277e-127Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.752010999 (31)gb:TOBBY2A_17253671e-80Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF049M13Sequence635010546 (89)gb:AB019427_1514277e-119Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.745008725 (23)gb:TOBBY2A_17253671e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF051O17Sequence674000858 (51)gb:AB019427_1514277e-108Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.119010546 (89)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023G06- ACTCGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMSF016F05- GGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF037J08- CTCGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF023N07- CTCGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMSF007A14- GGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMSF001E08- GGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF013G22- CTCGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMSF021E21- GGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF044L09- TTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFS082G04- TCCTTTCGCTATTCTCC
JMFF050J22- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF050H22- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF041G03- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF041J02- TTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF008N15- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF029I16- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF036O03- ATCCTTTCGCTATTCTCC
JMFF046N23- TTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF035J23- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF037O10- CTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF019I17- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF008N04- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF022L07- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF030E04- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF019M03- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF027H04- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF023L05- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF039C05- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF007K06- GCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
JMFF006H20- TTTCGGACTCGCTATCCTTTGGCTATTCTCC
JMSF046J12- GGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
                      ____________________________________________________________
consensus ACTGGCTCTTTCGGACTCGCTATCCTTTCGCTATTCTCC
 
. : . : . : . : . : . :
JMFF023G06- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMSF016F05- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF037J08- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF023N07- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMSF007A14- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMSF001E08- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF013G22- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMSF021E21- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF044L09- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFS082G04- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF050J22- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAAGTTCACATTAACATTGTGGTCAT
JMFF050H22- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAAGTTCACATTAACATTGTGGTCAT
JMFF041G03- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF041J02- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFS040F08- GAGAAGGTTCACATTAACATTGTGGTCAT
JMSF049M13- TAGGATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF008N15- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF029I16- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF036O03- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF046N23- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF035J23- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF037O10- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF019I17- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF008N04- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF022L07- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF030E04- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF019M03- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF027H04- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF023L05- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF039C05- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF007K06- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFS066E08- ATTAAATAGGATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMFF006H20- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMSF046J12- AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
JMSF023I24- GAAGGTTCACATTAACATTGTGGTCAT
                      ____________________________________________________________
consensus AGGTTTTGCTAAATAGAATAGAATGGGTAAGGAGAAGGTTCACATTAACATTGTGGTCAT
 
. : . : . : . : . : . :
JMFF023G06- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMSF016F05- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF037J08- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF023N07- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMSF007A14- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMSF001E08- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF013G22- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMSF021E21- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF044L09- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFS082G04- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF050J22- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF050H22- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF041G03- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF041J02- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFS040F08- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMSF049M13- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF008N15- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF029I16- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF036O03- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF046N23- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF035J23- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF037O10- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF019I17- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF008N04- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF022L07- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF030E04- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF019M03- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF027H04- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF023L05- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF039C05- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF007K06- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFS066E08- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMFF006H20- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMSF046J12- TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
JMSF023I24- TGGCCACGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
                      ____________________________________________________________
consensus TGGCCATGTCGACTCTGGTAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGAGG
 
. : . : . : . : . : . :
JMFF023G06- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMSF016F05- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF037J08- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF023N07- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMSF007A14- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAG
JMSF001E08- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF013G22- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMSF021E21- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF044L09- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFS082G04- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF050J22- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF050H22- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF041G03- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF041J02- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFS040F08- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMSF049M13- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAAATGAACAAGAGGTC
JMFF008N15- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF029I16- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF036O03- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF046N23- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF035J23- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF037O10- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF019I17- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF008N04- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF022L07- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF030E04- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF019M03- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF027H04- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF023L05- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF039C05- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFF007K06- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMFS066E08- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAAATGAACAAGAGGTC
JMFF006H20- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMSF046J12- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
JMSF023I24- AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAAATGAACAAGAGGTC
                      ____________________________________________________________
consensus AATTGACAAGCGTGTTATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTC
 
. : . : . : . : . : . :
JMFF023G06- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMSF016F05- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF037J08- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF023N07- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMSF001E08- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF013G22- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMSF021E21- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF044L09- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFS082G04- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF050J22- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF050H22- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF041G03- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF041J02- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFS040F08- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMSF049M13- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF008N15- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF029I16- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF036O03- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF046N23- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF035J23- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF037O10- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF019I17- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF008N04- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF022L07- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF030E04- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF019M03- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF027H04- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF023L05- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF039C05- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF007K06- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFS066E08- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMFF006H20- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMSF046J12- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
JMSF023I24- ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
                      ____________________________________________________________
consensus ATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAAGCTGAGAGGGAACGTGGTATCACCAT
 
. : . : . : . : . : . :
JMFF023G06- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMSF016F05- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF037J08- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF023N07- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMSF001E08- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF013G22- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMSF021E21- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF044L09- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFS082G04- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF050J22- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF050H22- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF041G03- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF041J02- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFS040F08- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMSF049M13- TGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF008N15- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF029I16- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF036O03- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF046N23- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF035J23- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF037O10- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF019I17- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF008N04- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF022L07- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF030E04- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF019M03- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF027H04- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF023L05- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF039C05- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF007K06- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFS066E08- TGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMFF006H20- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMSF046J12- CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
JMSF023I24- TGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
                      ____________________________________________________________
consensus CGATATTGCCTTGTGGAAATTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCC
 
. : . : . : . : . : . :
JMFF023G06- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMSF016F05- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF037J08- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF023N07- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMSF001E08- T
JMFF013G22- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMSF021E21- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF044L09- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFS082G04- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF050J22- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF050H22- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF041G03- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF041J02- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFS040F08- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMSF049M13- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGCGCTGT
JMFF008N15- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF029I16- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF036O03- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF046N23- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF035J23- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF037O10- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF019I17- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF008N04- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF022L07- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF030E04- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF019M03- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF027H04- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF023L05- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFF039C05- TGGACATCGTGACTTCATCNAAAACATGATTACTGGTACCTCAC
JMFF007K06- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMFS066E08- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGCGCTGT
JMFF006H20- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMSF046J12- TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
JMSF023I24- TGGACATCGTGACTTTATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
                      ____________________________________________________________
consensus TGGACATCGTGACTTCATCAAAAACATGATTACTGGTACCTCACAGGCAGATTGTGCTGT
 
. : . : . : . : . : . :
JMFF023G06- CCTCATCATTGACTCCACAACTGGTGGTT
JMSF016F05- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF037J08- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF023N07- CCTCATCATTGACTCCACAACTGGTGGTTT
JMFF013G22- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMSF021E21- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF044L09- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFS082G04- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF050J22- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF050H22- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF041G03- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF041J02- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFS040F08- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMSF049M13- CCTCATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF008N15- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF029I16- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF036O03- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF046N23- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF035J23- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF037O10- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF019I17- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF008N04- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF022L07- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF030E04- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF019M03- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF027H04- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF023L05- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF007K06- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFS066E08- CCTCATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMFF006H20- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMSF046J12- CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
JMSF023I24- CCTCATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
                      ____________________________________________________________
consensus CCTCATCATTGACTCCACAACTGGTGGTTTTGAGGCTGGTATTTCCAAGGATGGACAGAC
 
. : . : . : . : . : . :
JMSF016F05- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF037J08- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF013G22- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAAGCAAATGATTTGCTGCTGTA
JMSF021E21- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF044L09- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFS082G04- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF050J22- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGT-
JMFF050H22- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF041G03- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF041J02- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFS040F08- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMSF049M13- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF008N15- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF029I16- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF036O03- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF046N23- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF035J23- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF037O10- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF019I17- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF008N04- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF022L07- CCGTGGAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF030E04- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF019M03- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF027H04- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF023L05- CCGT-GAGCATGCTTTGCTTGCTTTCACC
JMFF007K06- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFS066E08- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMFF006H20- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMSF046J12- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
JMSF023I24- CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGCGGCAAATGATTTGCTGCTGTA
                      ____________________________________________________________
consensus CCGT-GAGCATGCTTTGCTTGCTTTCACCCTTGGTGTGAGGCAAATGATTTGCTGCTGTA
 
. : . : . : . : . : . :
JMSF016F05- ACAAGATGGATGCCACCACCCCCAAATACTCTAAG
JMFF037J08- ACAAGATGGATGCCACCACCCCCAAATACTCTAAG
JMFF013G22- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGA
JMSF021E21- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF044L09- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFS082G04- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF050J22- ACAAGATGGATGCCCCCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGT
JMFF050H22- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF041G03- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF041J02- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFS040F08- AC-AGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMSF049M13- ACAAGATGGATGCCACTACCCCCAAATACTCGAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF008N15- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF029I16- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF036O03- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF046N23- AC-AGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF035J23- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCC
JMFF037O10- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGC
JMFF019I17- ACAAGATGGATGCCACCACCCCCAAATACTCTAA
JMFF008N04- ACAAGATGGATGCCACCACCCCCAAATACTCTA
JMFF022L07- ACAAGATGGATGCCACCACCCCCAAATACTCTAA
JMFF030E04- ACAAGATGGATGCCACCACCC
JMFF019M03- ACAA
JMFF027H04- AC
JMFF007K06- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMFS066E08- ACAAGATGGATGCCACTACCCCCAAATACTCGAAGGCCAGGTACGATGAAATTGTGAAGG
JMFF006H20- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
JMSF046J12- ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTTAAGG
JMSF023I24- ACAAGATGGATGCCACTACCCCCAAATACTCGAAGGCCAGGTACGATGAAATTGTGAAGG
rJMSF038J03+ GAAGGCCAGGTACGATGAAATTGTGNAGG
                      ____________________________________________________________
consensus ACAAGATGGATGCCACCACCCCCAAATACTCTAAGGCCAGGTACGATGAAATTGTGAAGG
 
. : . : . : . : . : . :
JMSF021E21- AAGTCTCATCCTACATGAAGA
JMFF044L09- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
JMFS082G04- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
JMFF050H22- AAGTCTCATCCTACATGAAGAAAGTGGGATACAACCC
JMFF041G03- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
JMFF041J02- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
JMFS040F08- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
JMSF049M13- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
JMFF008N15- AAGTCTCATCCTACATGAAGAAG
JMFF029I16- AAGTCTCATCCTACATGA
JMFF036O03- AAGTCTCATCCTACATGA
JMFF046N23- AAGTCTCATCCTA
JMFF007K06- AAGTCTCATCCTACATGAA
JMFS066E08- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
JMFF006H20- AAGTCTCATCCTACATGA
JMSF046J12- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
JMSF023I24- AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
rJMSF038O22+ ATACAACCCTGACAAGATTCCATTTGTTCCCA
rJMSF038J03+ AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
                      ____________________________________________________________
consensus AAGTCTCATCCTACATGAAGAAGGTGGGATACAACCCTGACAAGATTCCATTTGTTCCCA
 
. : . : . : . : . : . :
JMFF044L09- TCTCTGGTTTT
JMFS082G04- TCT
JMFF041G03- TCTCTGG-TTTTGAGGG
JMFF041J02- TCTCTGG-TTNTGA-GGGAGACA
JMFS040F08- TCTCTGG-TTTTGA-GGGAGACAACATGATTGAGAGGTCAACCAA-CCTTGACTGGTACA
JMSF049M13- TCTCTGG-TTTTGA-GGGAGACAACATGATTGAGAGGTCAACCAA-CCTTGACTGG
JMFS066E08- TCTCTGGT
JMSF046J12- TCTCTGG-TTTTGA-GGGAGACAACATGATTGAGAGGTCAACCAA-CCTTGACTGGTACA
JMSF023I24- TCTCTGG-TTTTGA-GGGAGACAACATGATTGAGAGGTCAACCAA-CCTTGACTGGTACA
rJMSF038O22+ TCTCTGGTTTTTGAGGGGAGACAACATGATTGAGAGGTCAACCAACCCTTGACTGGTACA
JMFN043O23- ACCAA-CCTTGACTGGTACA
JMFN035C04- CAACATGATTGAGAGGTCAACCAA-CCTTGACTGGTACA
rJMSF038J03+ TCTCTGG-TTTTGA-GGGAGACAACATGATTGAGAGGTCAACCAA-CCTTGACTGGTACA
                      ____________________________________________________________
consensus TCTCTGG-TTTTGA-GGGAGACAACATGATTGAGAGGTCAACCAA-CCTTGACTGGTACA
 
. : . : . : . : . : . :
JMFS040F08- AG
JMSF046J12- AGGGACCAACCCTCCTTGAGGCACTTGACCTGATCCATGAGCCC
JMSF023I24- AGGGACCAACCCTCCTTGAGGCACTTGACCTGATCCATGAGCCCNAGANGCCATCTGAC
rJMSF038O22+ AGGGACCAACCCTCCTTGAGGCACTTGACCTGATCCATGAGCCCAAGAGGCCATCTGACA
JMFN043O23- AGGGACCAACCCTCCTTGAGGCACTTGACCTGATCCATGAGCCCAAGAGGCCATCTGACA
JMFN035C04- AGGGACCAACCCTCCTTGAGGCACTTGACCTGATCCATGAGCCCAAGAGGCCATCTGACA
rJMSF038J03+ AGGGACCAACCCTCCTTGAGGCACTTGACCTGATCCATGAGCCCAAGAGGCCATCTGACA
                      ____________________________________________________________
consensus AGGGACCAACCCTCCTTGAGGCACTTGACCTGATCCATGAGCCCAAGAGGCCATCTGACA
 
. : . : . : . : . : . :
rJMSF038O22+ AGCCCCTCCGACTTCCACTTCAGGATGTGTACAAGATTGGTGGTATTGGTACTGT-CCCT
rJMFF034J15+ TCAGGATGTGTACAAGATTGGTGGTATTGGTACTGTCCCCT
JMFN003B17- TTGGTACTGT-CCCT
rJMFF036K23+ AGGATGTGTACAAGATTGGTGGTATTGGTACTGT-CCCT
JMFN043O23- AGCCCCTCCGACTTCCACTTCAGGATGTGTACAAGATTGGTGGTATTGGTACTGT-CCCT
JMFN035C04- AGCCCCTCCGACTTCCACTTCAGGATGTGTACAAGATTGGTGGTATTGGTACTGT-CCCT
rJMSF038J03+ AGCCCCTCCGACTTCCACTTCAGGATGTGTACAAGATTGGTGGTATTGGTACTGT-CCCT
rJMFF035N22+ CAGGATGTGTACAAGATTGGTGGTATTGGTACTGTCCCCT
                      ____________________________________________________________
consensus AGCCCCTCCGACTTCCACTTCAGGATGTGTACAAGATTGGTGGTATTGGTACTGT-CCCT
 
. : . : . : . : . : . :
rJMSF038O22+ GTGGGTCGTGTGGAGACTGGTGTCCTGAAGCCCGGTATGGTTGTTACATTTGGACCTTCT
rJMFF034J15+ GTGGGTCGTGTGGAGACTGGTGTCCTGAAGCCCGGTATGGTTGTTACATTTGGACCTTCT
JMFN003B17- GTGGGTCGTGTGGAGACTGGTGTCCTGAAGCCCGGTATGGTTGTTACATTTGGACCTTCT
rJMFF036K23+ GTGGGTCGTGTGGAGACTGGTGTCCTGAAGCCCGGTATGGTTGTTACATTTGGACCTTCT
JMFN043O23- GTGGGTCGTGTGGAGACTGGTGTCCTGAAGCCGGGTATGGTTGTTACATTTGGACCTTCT
JMFN035C04- GTGGGTCGTGTGGAGACTGGTGTCCTGAAGCCCGGTATGGTTGTTACATTTGGACCTTCT
rJMSF038J03+ GTGGGTCGTGTGGAGACTGGTGTCCTGAAGCCCGGTATGGTTGTTACATTTGGACCTTCT
rJMFF035N22+ GTGGNTCGTGTGGAGACTGGTGTCCTGAAGCCCGGTATGGTTGTTACATTTGGACCTTCT
                      ____________________________________________________________
consensus GTGGGTCGTGTGGAGACTGGTGTCCTGAAGCCCGGTATGGTTGTTACATTTGGACCTTCT
 
. : . : . : . : . : . :
rJMSF038O22+ GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
rJMFF034J15+ GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
JMFN003B17- GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
rJMFF036K23+ GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
JMFN043O23- GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
JMFN035C04- GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
rJMSF038J03+ GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
rJMFF035N22+ GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
rJMFF008N05+ CCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
rJMFF007K05+ GTTAAGTCTGTTGAAATGCACCACGAAGCCNTTCAGGAGGCACTT
rJMFF031D23+ ACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
rJMSF023I24+ AGGAGGCACTT
rJMSF029C20+ TCAGGAGGCACTT
rJMSF014C03+ CACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
                      ____________________________________________________________
consensus GGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCACTT
 
. : . : . : . : . : . :
rJMSF038O22+ -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF034J15+ -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
JMFN003B17- -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF036K23+ -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
JMFN043O23- -CCCGGTGACAATGTTGGA-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
JMFN035C04- -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMSF038J03+ -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF035N22+ CCCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF008N05+ -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF044K21+ GACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF007K05+ -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF031D23+ -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMSF023I24+ -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMSF029C20+ -CCTGGTGACAATGNTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMSF014C03+ -CCTGGTGACAATGTTGGGTTTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF015E05+ CAATGTTGGN-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF024K08+ CAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF023P24+ AATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF040D18+ CAATGTTGGGTTTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF013E05+ TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF032O04+ AATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF010J23+ TGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF037H15+ CTTAAGCGTG
rJMFF022E02+ GG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF034J19+ GGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF006J11+ CAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF024O15+ CAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF001O11+ CAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF036D17+ GCGTG
rJMFF014A22+ CAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
rJMFF012F19+ GTG
rJMFF005M12+ CGTG
                      ____________________________________________________________
consensus -CCTGGTGACAATGTTGGG-TTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCGTG
 
. : . : . : . : . : . :
rJMSF038O22+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF034J15+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
JMFN003B17- GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF036K23+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
JMFN043O23- GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
JMFN035C04- GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMSF038J03+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF035N22+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF008N05+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF044K21+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF007K05+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF031D23+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMSF023I24+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMSF029C20+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMSF014C03+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF015E05+ GTTATGTTGCNTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF024K08+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF023P24+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF040D18+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF013E05+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGTCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF032O04+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF010J23+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF037H15+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF022E02+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF039E20+ AAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF032L02+ TAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACNTCTC
rJMFF034J19+ GTTATTTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF006J11+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF024O15+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF001O11+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF036D17+ GTTATGTTGCCTCAAACTNTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACNTCTC
rJMFF014A22+ GTTATGTTGCNTCAAACTNTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF005E14+ AAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMSF037B20+ TATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF012F19+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
rJMFF005M12+ GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
                      ____________________________________________________________
consensus GTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTCTC
 
. : . : . : . : . : . :
rJMSF038O22+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF034J15+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
JMFN003B17- AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF036K23+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
JMFN043O23- AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCCGTGCTGGAC
JMFN035C04- AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMSF038J03+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF035N22+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF008N05+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF044K21+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF007K05+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF031D23+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMSF023I24+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMSF029C20+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMSF014C03+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCC--TGCTGGAC
rJMFF015E05+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF024K08+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF023P24+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF040D18+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF013E05+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF032O04+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF010J23+ AGGTCATCATCATGAACCACCCTGGACCAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF037H15+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF022E02+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF039E20+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF032L02+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF034J19+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF006J11+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF024O15+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF001O11+ AGGTCATCATCATGAACCACCCTGGACCAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF036D17+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF001G15+ ATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF014A22+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF046G09+ TGGA-CAGATCGGTAAGGGATATGCTCCTGTGCTGGAC
rJMFF047K20+ TCCTGTGCTGGAC
rJMFF005E14+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMSF037B20+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF012F19+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF005M12+ AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF031D01+ GGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
rJMFF042A09+ GTGCTGGAC
                      ____________________________________________________________
consensus AGGTCATCATCATGAACCACCCTGGA-CAGATCGGTAATGGATATGCTCCTGTGCTGGAC
 
. : . : . : . : . : . :
rJMSF038O22+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF034J15+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
JMFN003B17- TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF036K23+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
JMFN043O23- TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
JMFN035C04- TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMSF038J03+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF035N22+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF008N05+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF044K21+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF007K05+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF031D23+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMSF023I24+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMSF029C20+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMSF014C03+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF015E05+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF024K08+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF023P24+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF040D18+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF013E05+ TGCCACACCCTCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF032O04+ TGCCACACCCTCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF010J23+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF037H15+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF022E02+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF039E20+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF032L02+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF034J19+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF006J11+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF024O15+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF001O11+ TGCCACACCTTCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF036D17+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF044G13+ CAAGATTGATAGACG
rJMFF001G15+ TGCCACACCNTCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF014A22+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF046G09+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF047K20+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATGNATAGACG
rJMFF005E14+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMSF037B20+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF012F19+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF005M12+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF031D01+ TGCCACACN-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF042A09+ TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF049N21+ ATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
rJMFF045I06+ ATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
                      ____________________________________________________________
consensus TGCCACACC-TCCCACATTGCAGTCAAGTTTGCTGAGCTTTTGACCAAGATTGATAGACG
 
. : . : . : . : . : . :
rJMSF038O22+ GTCTGGTAAGGAGCTGGAGGAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF034J15+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
JMFN003B17- GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF036K23+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
JMFN043O23- GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
JMFN035C04- GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF038J03+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF035N22+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF008N05+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF044K21+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF007K05+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF031D23+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF023I24+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF029C20+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF014C03+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF015E05+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF024K08+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF023P24+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF040D18+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF013E05+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF032O04+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF010J23+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF037H15+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF022E02+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF039E20+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF032L02+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF034J19+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF006J11+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF024O15+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF001O11+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF036D17+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF044G13+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF001G15+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF014A22+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF046G09+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF047K20+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF005E14+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF037B20+ GTCTGGTAAGGAGCTGGAGAAGGAGCCTAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF012F19+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF005M12+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF031D01+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF042A09+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCAGAAGAATGGTAATGCTGGTATGGT
JMFN020B21- AGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF049N21+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
JMFN014H03- CCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF045I06+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
                      ____________________________________________________________
consensus GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
 
. : . : . : . : . : . :
rJMSF038O22+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF034J15+ GAAGATGCTTCCAACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
JMFN003B17- GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF036K23+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
JMFN043O23- GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTG
JMFN035C04- GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTG
rJMSF038J03+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF035N22+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF008N05+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF044K21+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF007K05+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF031D23+ GGAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMSF023I24+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMSF029C20+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMSF014C03+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF015E05+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF024K08+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF023P24+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF040D18+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF013E05+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF032O04+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF010J23+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF037H15+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF022E02+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF039E20+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF032L02+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF034J19+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF006J11+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF024O15+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF001O11+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF036D17+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF044G13+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTTTCTGAGTACCCACCACTTG
rJMFF001G15+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF014A22+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF046G09+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF047K20+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF005E14+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMSF037B20+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF012F19+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF005M12+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF031D01+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF042A09+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
JMFN020B21- GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF049N21+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF030E05+ GCTTCCCACCAAGCCCATGGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
JMFN014H03- GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
rJMFF045I06+ GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
                      ____________________________________________________________
consensus GAAGATGCTTCCCACCAAGCCCAT-GGTTGTTGAAACCTTCTCTGAGTACCCACCACTTG
 
. : . : . : . : . : . :
rJMSF038O22+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF034J15+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
JMFN003B17- GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF036K23+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMSF038J03+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF035N22+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF008N05+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF044K21+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF007K05+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF031D23+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMSF023I24+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMSF029C20+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMSF014C03+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF015E05+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF024K08+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF023P24+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF040D18+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF013E05+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF032O04+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF010J23+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF037H15+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF022E02+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF039E20+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF032L02+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF034J19+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF006J11+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF024O15+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF001O11+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF036D17+ GTCGTTTTGCTGTGAGGGACATGTGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF044G13+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF001G15+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF014A22+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF046G09+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF047K20+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF005E14+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMSF037B20+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF012F19+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF005M12+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF031D01+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF042A09+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
JMFN020B21- GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF049N21+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF030E05+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF015P08+ GGTGTTATCAAGAATGTTG
rJMFF047K13+ AAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF046O24+ TTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
JMFN014H03- GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF046D21+ GCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
rJMFF045I06+ GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
                      ____________________________________________________________
consensus GTCGTTTTGCTGTGAGGGACATGAGACAAACGGTTGCAGTTGGTGTTATCAAGAATGTTG
 
. : . : . : . : . : . :
rJMSF038O22+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF034J15+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
JMFN003B17- ACAAGAAAGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF036K23+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMSF038J03+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF035N22+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF008N05+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF044K21+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGGAGTGAGCAT
rJMFF007K05+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF031D23+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMSF023I24+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMSF029C20+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMSF014C03+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF015E05+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF024K08+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF023P24+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF040D18+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF013E05+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF032O04+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF010J23+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF037H15+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF022E02+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF039E20+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF032L02+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF034J19+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF006J11+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF024O15+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF001O11+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF036D17+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF044G13+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF001G15+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF014A22+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF046G09+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF047K20+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF005E14+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMSF037B20+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTTAGCAT
rJMFF012F19+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF005M12+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF031D01+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF042A09+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
JMFN020B21- ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF049N21+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF030E05+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF015P08+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF047K13+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF046F19+ AGAAGTGAGCAT
rJMFF046O24+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMSF051O17+ CTGCTCNGAAGAAGAAGTGAGCAN
JMFN014H03- ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF046D21+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
rJMFF045I06+ ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
                      ____________________________________________________________
consensus ACAAGAAGGACCCAACTGGTGCCAAGGTTACCAAGGCTGCTCAGAAGAAGAAGTGAGCAT
 
. : . : . : . : . : . :
rJMSF038O22+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF034J15+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
JMFN003B17- GTGTTGCTATTGAATCT
rJMFF036K23+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMSF038J03+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF035N22+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTT-ATCTGCTTTTGTTATTTA
rJMFF008N05+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF044K21+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF007K05+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF031D23+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMSF023I24+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMSF029C20+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMSF014C03+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF015E05+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF024K08+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF023P24+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF040D18+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF013E05+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF032O04+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF010J23+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF037H15+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF022E02+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF039E20+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF032L02+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF034J19+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTT-ATCTGCTTTTGTTATTTA
rJMFF006J11+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF024O15+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF001O11+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF036D17+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF044G13+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF001G15+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF014A22+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF046G09+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF047K20+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF005E14+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMSF037B20+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF012F19+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF005M12+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF031D01+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF042A09+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
JMFN020B21- GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF049N21+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF030E05+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF015P08+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF047K13+ GTGTTGCTATTGAATCTCTTCTTTAAAGGGCTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF046F19+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF046O24+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF017G05+ TTTTTTATNTGNTTTTGTTATTTA
rJMSF051O17+ GTGTTGCTATTGANTCTCTTCTTTAAAGGACTATCTTTTTTNATCTGCTTTTGTTATNTA
JMFN014H03- GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF046D21+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
rJMFF045I06+ GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
                      ____________________________________________________________
consensus GTGTTGCTATTGAATCTCTTCTTTAAAGGACTATCTTTTTTTATCTGCTTTTGTTATTTA
 
. : . : . : . : . : . :
rJMSF038O22+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCC
rJMFF034J15+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCC
rJMFF036K23+ AATTTTGATAAACTT
rJMSF038J03+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTT
rJMFF035N22+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATA
rJMFF008N05+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF044K21+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF007K05+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF031D23+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMSF023I24+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMSF029C20+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMSF014C03+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF015E05+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF024K08+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF023P24+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF040D18+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF013E05+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTCTTATTATATG
rJMFF032O04+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF010J23+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF037H15+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF022E02+ AATTTTGATAAACTTTTGAGACTTTTTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF039E20+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF032L02+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF034J19+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF006J11+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF024O15+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF001O11+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF036D17+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF044G13+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF001G15+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF014A22+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF046G09+ AATTTTGATAAACTTTTGAGACTTTTTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF047K20+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTA
rJMFF005E14+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMSF037B20+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF012F19+ AATTTTGATAAACCTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF005M12+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF031D01+ AAATTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF042A09+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
JMFN020B21- AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF049N21+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF030E05+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF015P08+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF047K13+ AATTTTGATAAACTTTTAAGACTTTTTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF046F19+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF046O24+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF017G05+ AATTNTGATAAACTTNTAAGACTTTNTGATATAGCCCTTTGTAAGNCTTTTTATTATATG
rJMSF051O17+ AATTTNGATAAACTNTNAAGACTTTNTGATATAGC
JMFN014H03- AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF046D21+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
rJMFF045I06+ AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
                      ____________________________________________________________
consensus AATTTTGATAAACTTTTAAGACTTTCTGATATAGCCCTTTGTAAGACTTTTTATTATATG
 
. : . : . : . : . : . :
rJMFF008N05+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF044K21+ GCTCTAGTTGC
rJMFF007K05+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF031D23+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMSF023I24+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMSF029C20+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMSF014C03+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF015E05+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF024K08+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF023P24+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF040D18+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF013E05+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF032O04+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF010J23+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF037H15+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF022E02+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF039E20+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF032L02+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF034J19+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF006J11+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF024O15+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF001O11+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF036D17+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF044G13+ GCTCTAGTTGCTC
rJMFF001G15+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF014A22+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF046G09+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF005E14+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMSF037B20+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF012F19+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF005M12+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF031D01+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF042A09+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
JMFN020B21- GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF049N21+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF030E05+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF015P08+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF047K13+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTTTTATAGTGGGAGC
rJMFF046F19+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF046O24+ GCTCTAGTTGCTC
rJMFF017G05+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
JMFN014H03- GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF046D21+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
rJMFF045I06+ GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
                      ____________________________________________________________
consensus GCTCTAGTTGCTCATTCCATTGTGCCCTGCCTTGCAACCAATGATTCTTATAGTGGGAGC
 
. : . : . : . : . : . :
rJMFF008N05+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF007K05+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF031D23+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMSF023I24+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMSF029C20+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMSF014C03+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF015E05+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF024K08+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF023P24+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF040D18+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF013E05+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF032O04+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF010J23+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF037H15+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF022E02+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATNT
rJMFF039E20+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF032L02+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF034J19+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF006J11+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF024O15+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF001O11+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF036D17+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF001G15+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF014A22+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF046G09+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF005E14+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMSF037B20+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF012F19+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF005M12+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF031D01+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF042A09+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
JMFN020B21- AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF049N21+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF030E05+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF015P08+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF047K13+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF046F19+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF017G05+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
JMFN014H03- AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF046D21+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
rJMFF045I06+ AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
                      ____________________________________________________________
consensus AATTTTGTGTTTACTTGGTTGCTTAACGGGCAGTGATGGAAGCTTATCTGGATGCCATTT
 
. : . : . : . : . : . :
rJMFF008N05+ ATTTATACTCGTCT
rJMFF007K05+ ATTTATACTCGTCTACT
rJMFF031D23+ ATTTATACTCGTCTA
rJMSF023I24+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTT
rJMSF029C20+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTT
rJMSF014C03+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTT
rJMFF015E05+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF024K08+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF023P24+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF040D18+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF013E05+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGT
rJMFF032O04+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF010J23+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF037H15+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF022E02+ ATTTATACTCGT
rJMFF039E20+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF032L02+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF034J19+ AT
rJMFF006J11+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF024O15+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTT
rJMFF001O11+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG
rJMFF036D17+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF001G15+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAG-TTCAA
rJMFF014A22+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF046G09+ ATTTATACTCGTCTACTGTTTTAGATA
rJMFF005E14+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMSF037B20+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAG
rJMFF012F19+ ATTTATACTCGTCTACT
rJMFF005M12+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF031D01+ ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF042A09+ ATTTATACTCGTCTACTGTTTTAGAGATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
JMFN020B21- ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF049N21+ ATTTATACTCGTCTACTGTTTNAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF030E05+ ATTTATACTCGTCTACT
rJMFF015P08+ ATTTATACTCGTCTACTGTTTTAGATAT
rJMFF047K13+ ATTTATACTCGTCTACTGTTTTAG
rJMFF046F19+ ATTTATACTCGTATACTGTTTAAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF017G05+ ATTTATACTCGTNTACTGTTTTAGATATGTGCAGACTNTTGTCGGTTAAAA
JMFN014H03- ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF046D21+ ATTTATACTCGTCTACTGTTTNAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
rJMFF045I06+ ATTTATACTCGTCTATTGTTTNAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
                      ____________________________________________________________
consensus ATTTATACTCGTCTACTGTTTTAGATATGTGCAGACTTTTGTCGGTTAAAACAGTTTCAA
 
. : . : . : . : . : . :
rJMFF015E05+ TT
rJMFF024K08+ T
rJMFF023P24+ T
rJMFF040D18+ T
rJMFF037H15+ T
rJMFF039E20+ T
rJMFF032L02+ T
rJMFF006J11+ T
rJMFF036D17+ TT
rJMFF001G15+ T
rJMFF014A22+ TT
rJMFF005E14+ T
rJMFF005M12+ TTAA
rJMFF031D01+ TT-AAG
rJMFF042A09+ TT-AAGTGTGC
JMFN020B21- TT-AAGTGTGC
rJMFF049N21+ TT-AAGTGTGCAATTATTCC
rJMFF046F19+ TTAAAGTGTGCAATTATTCC
JMFN014H03- TT-AAGTGTGCAATTATTCC
rJMFF046D21+ TT-AAGTGTGCAATTATTCCAAAAAAAAAAAAAAACTCTCCAGGGT
rJMFF045I06+ TT-AAGTGTGCAATTATTCCAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TT-AAGTGTGCAATTATTCCAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG