Previous Contig 010531:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O03Sequence480005474 (26)gb:AY326307_15996582e-11Cucurbita maxima gibberellic acid insensitive phloem B (GAIP-B) mRNA, complete c722010531 (22)gb:AF378125_17933445e-74Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF007O08Sequence463005474 (26)gb:AF378125_17933446e-06Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.722010531 (22)gb:AF378125_17933445e-74Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF013J02Sequence537005474 (26)gb:AF378125_17933442e-13Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.692010531 (22)gb:AF378125_17933442e-69Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF024H24Sequence746010531 (22)gb:AF378125_17933441e-77Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF036N08Sequence466005474 (26)gb:AY326307_15996582e-12Cucurbita maxima gibberellic acid insensitive phloem B (GAIP-B) mRNA, complete c650010531 (22)gb:AF378125_17933442e-66Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF038L12Sequence442005474 (26)gb:AY269087_15940270.008Lycopersicon esculentum GAI-like protein mRNA, complete cds.740010531 (22)gb:AF378125_17933442e-78Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF045G18Sequence638005474 (26)gb:AF378125_17933443e-22Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.626010531 (22)gb:AF378125_17933443e-43Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF050L17Sequence621005474 (26)gb:AF378125_17933446e-22Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.589010531 (22)gb:AY269087_15940273e-43Lycopersicon esculentum GAI-like protein mRNA, complete cds.
JMFN013G08Sequence609010531 (22)gb:AF378125_17933441e-53Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFN037E16Sequence228010531 (22)gb:AF492578_18049373e-31Calycadenia multiglandulosa clone CLmCod7 GIA/RGA-like gibberellin response modu
JMFS058E06Sequence627010531 (22)gb:AF378125_17933441e-75Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF003F19Sequence391005474 (26)732010531 (22)gb:AF378125_17933441e-78Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF003F20Sequence345005474 (26)733010531 (22)gb:AF378125_17933441e-78Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF006B21Sequence288004772 (7)gb:AY635907_16188190.003Glycine max digalactosyldiacylglycerol synthase 1 (DGD1) mRNA, complete cds.245010531 (22)gb:AY269087_15940272e-08Lycopersicon esculentum GAI-like protein mRNA, complete cds.
JMSF014G22Sequence350005474 (26)742010531 (22)gb:AF378125_17933441e-80Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF014P05Sequence468005474 (26)gb:AY269087_15940271e-08Lycopersicon esculentum GAI-like protein mRNA, complete cds.751010531 (22)gb:AF378125_17933446e-73Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF014P15Sequence440005474 (26)gb:AY269087_15940270.024Lycopersicon esculentum GAI-like protein mRNA, complete cds.766010531 (22)gb:AF378125_17933441e-79Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF023C14Sequence608005474 (26)gb:AF378125_17933444e-25Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.756010531 (22)gb:AF378125_17933446e-79Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF024O22Sequence596005474 (26)gb:AF378125_17933442e-24Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.736010531 (22)gb:AF378125_17933445e-81Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF030K18Sequence354005474 (26)665010531 (22)gb:AF378125_17933445e-73Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF049G08Sequence697005474 (26)gb:AF378125_17933442e-32Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.759010531 (22)gb:AF378125_17933445e-73Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF051C10Sequence672005474 (26)gb:AF378125_17933442e-25Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.735010531 (22)gb:AF378125_17933443e-82Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051C10+ TCGACGCCTCGATGTTCA
rJMSF024O22+ TCA
rJMSF003F19+ TCA
rJMSF003F20+ TCA
rJMSF014G22+ TCA
                      ____________________________________________________________
consensus TCGACGCCTCGATGTTCA
 
. : . : . : . : . : . :
rJMSF051C10+ ACATCCAGGACGGCGAGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
rJMSF024O22+ ACATCCAGGACGGCGAGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
rJMSF003F19+ ACATCCAGGACGGCGAGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGNTGCTCG
rJMSF003F20+ ACATCCAGGACGGCGAGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
rJMSF014G22+ ACATCCAGGACGGCGAGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
rJMSF023C14+ CGGCGAGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
rJMFF038L12+ GGCGAGACGGTGNCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
JMFS058E06- TGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
rJMFF024H24+ AGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
rJMFF013J02+ TCCATCAGCTGCTCG
rJMSF030K18+ AGCTCCATCAGCTGCTCG
rJMFF002O03+ CGAGCTCCATCAGCTGCTCG
rJMFF007O08+ GAGCTCCATCAGCTGCTCG
rJMSF014P15+ CAGGACGGCGAGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
rJMSF014P05+ CCATCAGCTGCTCG
rJMSF049G08+ CCATCAGCTGCTCG
                      ____________________________________________________________
consensus ACATCCAGGACGGCGAGACGGTGGCCGTTAACTCCATCTTCGAGCTCCATCAGCTGCTCG
 
. : . : . : . : . : . :
rJMSF051C10+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMSF024O22+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMSF003F19+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMSF003F20+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAGGCCGGAGATC
rJMSF014G22+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMSF023C14+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMFF038L12+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
JMFS058E06- CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMFF024H24+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMFF013J02+ CCCGCCCCCGGCGCCATNGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMSF030K18+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCNGTCGTGCAGGACATGAAGCCGGAGATC
rJMFF036N08+ CCGGCGCCATCGAGAAGNTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMFF002O03+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMFF007O08+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMSF014P15+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMSF014P05+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
rJMSF049G08+ CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
                      ____________________________________________________________
consensus CCCG-CCCCGGCGCCATCGAGAAGGTTCTATCCGTCGTGCAGGACATGAAGCCGGAGATC
 
. : . : . : . : . : . :
rJMSF051C10+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMSF024O22+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMSF003F19+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMSF003F20+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMSF014G22+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMSF023C14+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMFF038L12+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
JMFS058E06- GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMFF024H24+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMFF013J02+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMSF030K18+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMFF036N08+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMFF002O03+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMFF007O08+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMSF014P15+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
JMFN013G08- TTTTCATGGACCGGTTCACC
rJMSF014P05+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
rJMSF049G08+ GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
                      ____________________________________________________________
consensus GTGACGGTGGTCGAGCAGGAGGCGAATCATAACGGTCCGGTTTTCATGGACCGGTTCACC
 
. : . : . : . : . : . :
rJMSF051C10+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF024O22+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF003F19+ GAGTCCTTGCATTACTACTCCACCCTCTTNGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF003F20+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF014G22+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF023C14+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMFF038L12+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
JMFS058E06- GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMFF024H24+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMFF013J02+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF030K18+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMFF036N08+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGNTGGAAGGATGCGCCGCCAGCGAA
rJMFF002O03+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMFF007O08+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF014P15+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
JMFN013G08- GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF014P05+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMSF049G08+ GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
rJMFF050L17+ CGCTGGAAGGATGCGCCGCCAGCGAA
rJMFF045G18+ TCGCTGGAAGGATGCGCCGCCAGCGAA
                      ____________________________________________________________
consensus GAGTCCTTGCATTACTACTCCACCCTCTTCGACTCGCTGGAAGGATGCGCCGCCAGCGAA
 
. : . : . : . : . : . :
rJMSF051C10+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF024O22+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF003F19+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF003F20+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF014G22+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF023C14+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMFF038L12+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
JMFS058E06- GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMFF024H24+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMFF013J02+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF030K18+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMFF036N08+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMFF002O03+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMFF007O08+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF014P15+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
JMFN037E16- CGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
JMFN013G08- GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF014P05+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMSF049G08+ GGCGGCGCGGTGTGCAACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMFF050L17+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
rJMFF045G18+ GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
                      ____________________________________________________________
consensus GGCGGCGCGGTGTGCGACCAAGATAAGGTGATGTCGGAGGTGTATTTGGGGCGGCAGATC
 
. : . : . : . : . : . :
rJMSF051C10+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF024O22+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF003F19+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF003F20+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF014G22+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF023C14+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMFF038L12+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
JMFS058E06- TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMFF024H24+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMFF013J02+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF030K18+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMFF036N08+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCNCCACGAGACGTTGGCACAG
rJMFF002O03+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMFF007O08+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF014P15+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
JMFN037E16- TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
JMFN013G08- TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF014P05+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMSF049G08+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMFF050L17+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
rJMFF045G18+ TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
                      ____________________________________________________________
consensus TGTAACGTGGTGGCGTGCGAGGGCGTGGACCGGGTCGAGCGCCACGAGACGTTGGCACAG
 
. : . : . : . : . : . :
rJMSF051C10+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF024O22+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF003F19+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF003F20+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF014G22+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF023C14+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMFF038L12+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
JMFS058E06- TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMFF024H24+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMFF013J02+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF030K18+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTNTAATGCCTAC
rJMFF036N08+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTNTAATGCCTAC
rJMFF002O03+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMFF007O08+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF014P15+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
JMFN037E16- TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
JMFN013G08- TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF014P05+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMSF049G08+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMFF050L17+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
rJMFF045G18+ TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
                      ____________________________________________________________
consensus TGGAGAACCCGGTTCAAGTCCGCCGGATTCTCCGCGGTTCACTTGGGCTCTAATGCCTAC
 
. : . : . : . : . : . :
rJMSF051C10+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF024O22+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF003F19+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF003F20+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF014G22+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF023C14+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMFF038L12+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
JMFS058E06- AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMFF024H24+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMFF013J02+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF030K18+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMFF036N08+ AAGCAAGNTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMFF002O03+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMFF007O08+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF014P15+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
JMFN037E16- AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF006B21+ CGCCGGCGGAGANGGNTNCAGAGTGGAAGAG
JMFN013G08- AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF014P05+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMSF049G08+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMFF050L17+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
rJMFF045G18+ AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
                      ____________________________________________________________
consensus AAGCAAGCTAGTATGCTGTTGGCCCTGTTCGCCGGCGGAGATGGGTACAGAGTGGAAGAG
 
. : . : . : . : . : . :
rJMSF051C10+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMSF024O22+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMSF003F19+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMSF003F20+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGTGGCCACTCATTGCCACCTCGGCCTGG
rJMSF014G22+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMSF023C14+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMFF038L12+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
JMFS058E06- AACGACGGCGGGTTGACGCTGGGTTCGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMFF024H24+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMFF013J02+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMSF030K18+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMFF036N08+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMFF002O03+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMFF007O08+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMSF014P15+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
JMFN037E16- AA
rJMSF006B21+ AACGACGGCGGGNTGNCGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
JMFN013G08- AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMSF014P05+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMSF049G08+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMFF050L17+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
rJMFF045G18+ AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
                      ____________________________________________________________
consensus AACGACGGCGGGTTGACGCTGGGTTGGCACACGAGGCCACTCATTGCCACCTCGGCCTGG
 
. : . : . : . : . : . :
rJMSF051C10+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF024O22+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF003F19+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF003F20+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF014G22+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF023C14+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMFF038L12+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
JMFS058E06- AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMFF024H24+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMFF013J02+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF030K18+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMFF036N08+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMFF002O03+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMFF007O08+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF014P15+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF006B21+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGANCTATTGGCGGTTCAGAATCTCGG
JMFN013G08- AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF014P05+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMSF049G08+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMFF050L17+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
rJMFF045G18+ AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
                      ____________________________________________________________
consensus AAACTCACCAGTTAACTCACCGAGTCAGATCATGGAGCTATTGGCGGTTCAGAATCTCGG
 
. : . : . : . : . : . :
rJMSF051C10+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF024O22+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF003F19+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF003F20+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF014G22+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF023C14+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMFF038L12+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
JMFS058E06- TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCG
rJMFF024H24+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMFF013J02+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF030K18+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMFF036N08+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMFF002O03+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMFF007O08+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF014P15+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF006B21+ TTTNGTGAGTCCGGTTTGGCAGGATGGANGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
JMFN013G08- TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF014P05+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMSF049G08+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMFF050L17+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
rJMFF045G18+ TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
                      ____________________________________________________________
consensus TTTTGTGAGTCCGGTTTGGCAGGATGGATGGAGACTCGCCGGTTCGCCGGCTCGCCTCCC
 
. : . : . : . : . : . :
rJMSF051C10+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTT
rJMSF024O22+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMSF003F19+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMSF003F20+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTTAACTGTATTTATTTATATTTTG
rJMSF014G22+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMSF023C14+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMFF038L12+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMFF024H24+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMFF013J02+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMSF030K18+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTA
rJMFF036N08+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTNT-ACTGTATTTATTTATATTT
rJMFF002O03+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMFF007O08+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMSF014P15+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMSF006B21+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAA
JMFN013G08- AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMSF014P05+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMSF049G08+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMFF050L17+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
rJMFF045G18+ AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
                      ____________________________________________________________
consensus AGCAAATCTGTTTTTTACCAAAGTTAGTTTGGAATTTT-ACTGTATTTATTTATATTTTG
 
. : . : . : . : . : . :
rJMSF024O22+ TGAATGGA
rJMSF003F19+ TGAATGGATTA
rJMSF003F20+ TGAATGGATTA
rJMSF014G22+ TGAATGGATTATGATGC
rJMSF023C14+ TGAATGGATTATGATGCTGTAATTTTAAGAATTTGAAGGGTGAATCTG
rJMFF038L12+ TGAATGGATTATGATGCTGTAATTTTAAGAATT
rJMFF024H24+ TGAATGGATTATGATGCTGTAATTTTAAGAATT
rJMFF013J02+ TGAATGGATTATGATGCT
rJMFF002O03+ TGAATGGATTATGATGCTGTAATTTTAAGAATT
rJMFF007O08+ TGAATGGATTATGATGCTGTAATTTTAAGAATT
rJMSF014P15+ TGAATGGATTATGATGCTGTAATTTTAAGAATTTGAAGGGTGAATCTGGAAAT
JMFN013G08- NGAATGGATTATGATGCTGTAATTTTAAGAATTTGAAGGGTGAATCTGGA
rJMSF014P05+ TGAATGGATTATGATGCTGTAATTTTAAGAATTTGAAGGGTGAATCTGGAAATTGGTCAA
rJMSF049G08+ TGAATGGATTATGATGCTGTAATTTTAAGAATTTGAAGGGTGAATCTGGAAATTGGTCAA
rJMFF050L17+ TGAATGGATTATGATGCTGTAATTTTAAGAATTTGAAGGGTGAATCTGGAAATTGGTCAA
rJMFF045G18+ TGAATGGATTATGATGCTGTAATTTTAAGAATTTGAAGGGTGAATCTGGAAATTGGTCAA
                      ____________________________________________________________
consensus TGAATGGATTATGATGCTGTAATTTTAAGAATTTGAAGGGTGAATCTGGAAATTGGTCAA
 
. : . : . : . : . : . :
rJMSF014P05+ TGTGTATTTAATATT
rJMSF049G08+ TGTGTATTTAATATT
rJMFF050L17+ TGTGTATTTAATATT
rJMFF045G18+ TGTGTATTTAATATTAAAAAAAAAAAAAAAAAGAAAAAAAGAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGTGTATTTAATATTAAAAAAAAAAAAAAAAAGAAAAAAAGAAAAAAAACTCTCCAGGGT