Previous Contig 010525:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001G16Sequence608007954 (5)gb:BT004563_16375973e-22Arabidopsis thaliana At2g18100 gene, complete cds.769010525 (6)pir|C84560|C845605e-65hypothetical protein At2g18100 [imported] - Arabidopsis thaliana>gb:AC006201_153
JMFF001K22Sequence584007954 (5)gb:BT004563_16375975e-18Arabidopsis thaliana At2g18100 gene, complete cds.545010525 (6)gb:BT004563_16375971e-28Arabidopsis thaliana At2g18100 gene, complete cds.
JMFF045F11Sequence646007954 (5)gb:BT004563_16375973e-24Arabidopsis thaliana At2g18100 gene, complete cds.628010525 (6)gb:BT004563_16375973e-33Arabidopsis thaliana At2g18100 gene, complete cds.
JMFS021B10Sequence629010525 (6)pir|T04590|T045904e-39hypothetical protein F23E13.100 - Arabidopsis thaliana>gb:ATCHRIV85_1547581 Arab
JMSF046A02Sequence682007954 (5)gb:BT004563_16375976e-26Arabidopsis thaliana At2g18100 gene, complete cds.832010525 (6)pir|C84560|C845606e-65hypothetical protein At2g18100 [imported] - Arabidopsis thaliana>gb:AC006201_153
JMSF049O20Sequence679007954 (5)gb:BT004563_16375976e-26Arabidopsis thaliana At2g18100 gene, complete cds.784010525 (6)pir|C84560|C845606e-67hypothetical protein At2g18100 [imported] - Arabidopsis thaliana>gb:AC006201_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS021B10- GCCGAATCT
                      ____________________________________________________________
consensus GCCGAATCT
 
. : . : . : . : . : . :
JMFS021B10- TCTAAAAGCAGATGGGCTAAGTGGAGACGTGGAGGTATCATAGGTGCAGCAGCATTGACA
                      ____________________________________________________________
consensus TCTAAAAGCAGATGGGCTAAGTGGAGACGTGGAGGTATCATAGGTGCAGCAGCATTGACA
 
. : . : . : . : . : . :
JMFS021B10- GGAGGAACATTAATGGCGATTACTGGTGGTTTAGCTGCTCCAGCCATTGCTGCAGGGTTT
                      ____________________________________________________________
consensus GGAGGAACATTAATGGCGATTACTGGTGGTTTAGCTGCTCCAGCCATTGCTGCAGGGTTT
 
. : . : . : . : . : . :
JMFS021B10- GGTGCTTTAGCTCCAACATTGGGAACTCTTGTTCCTGTGATTGGAGCAAGTGGGTTCGCT
                      ____________________________________________________________
consensus GGTGCTTTAGCTCCAACATTGGGAACTCTTGTTCCTGTGATTGGAGCAAGTGGGTTCGCT
 
. : . : . : . : . : . :
JMFS021B10- GCGGTTGCCACTGCTGCAGGAAGTGTTGTTGGCTCTGTCGCAGTTGCTGCATCATTTGGA
                      ____________________________________________________________
consensus GCGGTTGCCACTGCTGCAGGAAGTGTTGTTGGCTCTGTCGCAGTTGCTGCATCATTTGGA
 
. : . : . : . : . : . :
JMFS021B10- GCTGCCGGAGCGGGACTTACAGGGTCTAAAGTGGCTCGGAGAATGGGAGATGTTGATGAA
                      ____________________________________________________________
consensus GCTGCCGGAGCGGGACTTACAGGGTCTAAAGTGGCTCGGAGAATGGGAGATGTTGATGAA
 
. : . : . : . : . : . :
JMFS021B10- TTTGAGTTTAAAACAATAGGGCAAAACCATAACAAAGGCCGGCTAGCAGTTGAGATATTA
                      ____________________________________________________________
consensus TTTGAGTTTAAAACAATAGGGCAAAACCATAACAAAGGCCGGCTAGCAGTTGAGATATTA
 
. : . : . : . : . : . :
JMFS021B10- ATCACTGGATTTGTTTTCGAGGAGAGTGATTTTTTTAGACCTTGGGAAGGCGAATACAAT
                      ____________________________________________________________
consensus ATCACTGGATTTGTTTTCGAGGAGAGTGATTTTTTTAGACCTTGGGAAGGCGAATACAAT
 
. : . : . : . : . : . :
JMFS021B10- AACTTGGAAAGATATGCACTGCAGTGGGAGTCTAAGCATCTAATGGCTGTAAGCTATGCA
                      ____________________________________________________________
consensus AACTTGGAAAGATATGCACTGCAGTGGGAGTCTAAGCATCTAATGGCTGTAAGCTATGCA
 
. : . : . : . : . : . :
JMFS021B10- ATTAGGAATTGGCTTACTTCAAGTATTGCTCTTGAATTAATGAAGCGAGGTGCCATGATG
rJMSF046A02+ AGGTGCCATGATG
                      ____________________________________________________________
consensus ATTAGGAATTGGCTTACTTCAAGTATTGCTCTTGAATTAATGAAGCGAGGTGCCATGATG
 
. : . : . : . : . : . :
JMFS021B10- ACAGTATTGAGCTCTTTCTTAACAGCCTTGGCTT--GGCCAGCAACATTACTTGCTCTTA
rJMSF046A02+ ACAGTATTGAGCTCTTTCTTAACAGCCTTGGCTTNGGCCCAGCAACATTACTTGCTCTTA
rJMSF049O20+ CCAGCAACNNTACTTGCTCTTA
rJMFF001G16+ TA
                      ____________________________________________________________
consensus ACAGTATTGAGCTCTTTCTTAACAGCCTTGGCTTNGGGCCAGCAACATTACTTGCTCTTA
 
. : . : . : . : . : . :
JMFS021B10- CTCATTTTATTGACAGTGAATG
rJMSF046A02+ CTCATTTTATTGACAGTGAATGGACAATTGCTGTAGACAGATCTGATAAGGCTGGAATAC
rJMSF049O20+ CTCATTTTATTGACAGTGAATGGACAATTGCTGTAGACAGATCTGATAAGGCTGGAATAC
rJMFF001G16+ CTCATTTTATTGACAGTGAATGGACAATTGCTGTAGACAGATCTGATAAGGCTGGAATAC
                      ____________________________________________________________
consensus CTCATTTTATTGACAGTGAATGGACAATTGCTGTAGACAGATCTGATAAGGCTGGAATAC
 
. : . : . : . : . : . :
rJMSF046A02+ TGCTGGCAGAGGTTCTGCAGAAAGGATTGCAAGGGCACAGGCCTGTGACACTAGTTGGTT
rJMSF049O20+ TGCTGGCAGAGGTTCTGCAGAAAGGATTGCAAGGGCACAGGCCTGTGACACTAGTTGGTT
rJMFF001G16+ TGCTGGCAGAGGTTCTGCAGAAAGGATTGCAAGGGCACAGGCCTGTGACACTAGTTGGTT
                      ____________________________________________________________
consensus TGCTGGCAGAGGTTCTGCAGAAAGGATTGCAAGGGCACAGGCCTGTGACACTAGTTGGTT
 
. : . : . : . : . : . :
rJMSF046A02+ TTTCGCTGGGGGCAAGAGTAATCTTCAAATGTCTTCAGATTTTGGCTGCCAGTGGCAATA
rJMSF049O20+ TTTCGCTGGGGGCAAGAGTAATCTTCAAATGTCTTCAGATTTTGGCTGCCAGTGGCAATA
rJMFF001K22+ TGGCAATA
rJMFF001G16+ TTTCGCTGGGGGCAAGAGTAATCTTCAAATGTCTTCAGATTTTGGCTGCCAGTGGCAATA
                      ____________________________________________________________
consensus TTTCGCTGGGGGCAAGAGTAATCTTCAAATGTCTTCAGATTTTGGCTGCCAGTGGCAATA
 
. : . : . : . : . : . :
rJMSF046A02+ ATGCCGGACTTGTAGAAAGAGTTGTTCTTCTTGGGGCGCCAATTAGGATTAGAGATGTGA
rJMSF049O20+ ATGCCGGACTTGTAGAAAGAGTTGTTCTTCTTGGGGCGCCAATTAGGATTAGAGATGTGA
rJMFF001K22+ ATNCCGGACTTNTANAAAGAGTNGTTCTTNTTGGGGCGCCAATTAGGATTAGAGACGTGA
rJMFF001G16+ ATGCCGGACTTGTAGAAAGAGTTGTTCTTCTTGGGGCGCCAATTAGGATTAGAGATGTGA
rJMFF045F11+ GGGGCGCCAATTAGGATNAGAGATGTGA
                      ____________________________________________________________
consensus ATGCCGGACTTGTAGAAAGAGTTGTTCTTCTTGGGGCGCCAATTAGGATTAGAGATGTGA
 
. : . : . : . : . : . :
rJMSF046A02+ ACTGGGAAGCAGTTAGAAAGGTGGTGGCTGGGAGGTTTATTAATGTCTATTCTACAAATG
rJMSF049O20+ ACTGGGAAGCAGTTAGAAAGGTGGTGGCTGGGAGGTTTATTAATGTCTATTCTACAAATG
rJMFF001K22+ ACTNGGAAGCAGTTAGAAAGGTGGTGGCTGGGAGGTTTATTAANGTCTATTCTACAAANG
rJMFF001G16+ ACTGGGAAGCAGTTAGAAAGGTGGTGGCTGGGAGGTTTATTAATGTCTATTCTACAAATG
rJMFF045F11+ ACTGGGAAGCAGTTAGAAAGGTGGTGGCTGGGAGGTTTATTAATGTCTATTCTACAAATG
                      ____________________________________________________________
consensus ACTGGGAAGCAGTTAGAAAGGTGGTGGCTGGGAGGTTTATTAATGTCTATTCTACAAATG
 
. : . : . : . : . : . :
rJMSF046A02+ ATTGGATGCTTGGAATTGTCTTTCGTGCTAGTCTCCTGAGTCAAGGGCTAGCTGGGATTC
rJMSF049O20+ ATTGGATGCTTGGAATTGTCTTTCGTGCTAGTCTCCTGAGTCAAGGGCTAGCTGGGATTC
rJMFF001K22+ ATTGGATGCTTGGAATTGTCNNTCGTGCTAGTNTCNTGAGTCAAGGGCTAGCTGGGATTC
rJMFF001G16+ ATTGGATGCTTGGAATTGTCTTTCGTGCTAGTCTCCTGAGTCAAGGGCTAGCTGGGATTC
rJMFF045F11+ ATTGGATGCTTGGAATTGTCTTTCGTGCTAGTCTCCTGAGTCAAGGGCTAGCTGGGATTC
                      ____________________________________________________________
consensus ATTGGATGCTTGGAATTGTCTTTCGTGCTAGTCTCCTGAGTCAAGGGCTAGCTGGGATTC
 
. : . : . : . : . : . :
rJMSF046A02+ AACCGGTTGATGTTCCTGGAGTCGAGAATGTTGATGTAACAGAACTGATTGATGGCCACT
rJMSF049O20+ AACCGGTTGATGTTCCTGGAGTCGAGAATGTTGATGTAACAGAACTGATTGATGGCCACT
rJMFF001K22+ ANCCGGTTGATGTTCCTGGAGTCGAGAATGTTGATGTAACAGNNCTGATTGATGGCCACT
rJMFF001G16+ AACCGGTTGATGTTCCTGGAGTCGAGAATGTTGATGTAACAGAACTGATTGATGGCCACT
rJMFF045F11+ AACCGGTTGATGTTCCTGGAGTCGAGAATGTTGATGTAACAGAACTGATTGATGGCCACT
                      ____________________________________________________________
consensus AACCGGTTGATGTTCCTGGAGTCGAGAATGTTGATGTAACAGAACTGATTGATGGCCACT
 
. : . : . : . : . : . :
rJMSF046A02+ CTGCATATTTGTGGACTAGCCAAGAGATTCTAGAACTGCTTCAGCTGGACACATATTATC
rJMSF049O20+ CTGCATATTTGTGGACTAGCCAAGAGATTCTAGAACTGCTTCAGCTGGACACATATTATC
rJMFF001K22+ CTGCATNNTTGTGGNNTAGCCAAGAGATTCTAGNACTGCTTCAGCTGGACACATATTATC
rJMFF001G16+ CTGCATATTTGTGGACTAGCCAAGAGATTCTAGAACTGCTTCAGCTGGACACATATTATC
rJMFF045F11+ CTGCATATTTGTGGACTAGCCAAGAGATTCTAGAACTGCTTCAGCTGGACACATATTATC
                      ____________________________________________________________
consensus CTGCATATTTGTGGACTAGCCAAGAGATTCTAGAACTGCTTCAGCTGGACACATATTATC
 
. : . : . : . : . : . :
rJMSF046A02+ CTGTTTTTGGTCGCGCTTCGAGATAGGACTTGCGTCATATTTTGCCGTTGATTTTCAGCT
rJMSF049O20+ CTGTTTTTGGTCGCGCTTCGAGATAGGACTTGCGTCATATTTTGCCGTTGATTTTCAGCT
rJMFF001K22+ CTGTTTTTGGTCGCGCTTCGAGATAGGACTTGCGTCATATTTTGCCGTCGATTNTCAGCT
rJMFF001G16+ CTGTTTTTGGTCGCGCTTCGAGATAGGACTTGCGTCATATTTTGCCGTTGATTTTCAGCT
rJMFF045F11+ CTGTTTTTGGTCGCGCTTCGAGATAGGACTTGCGTCATATTTTGCCGTTGATTTTCAGCT
                      ____________________________________________________________
consensus CTGTTTTTGGTCGCGCTTCGAGATAGGACTTGCGTCATATTTTGCCGTTGATTTTCAGCT
 
. : . : . : . : . : . :
rJMSF046A02+ TACAAGACAGGGTACAGAATTCAAAACTGAGGAAGGGGGTGTAAACTGTAAAGGGGTTAT
rJMSF049O20+ TACAAGACAGGGTACAGAATTCAAAACTGAGGAAGGGGGTGTAAACTGTAAAGGGGTTAT
rJMFF001K22+ TACAAGNCAGGGTACAGAATTCNNNACTGAGGAAGGGGGTGTAAACTGTAAAGGGGTTAT
rJMFF001G16+ TACAAGACAGGGTACAGAATTCAAAACTGAGGAAGGGGGTGTAAACTGTAAAGGGGTTAT
rJMFF045F11+ TACAAGACAGGGTACAGAATTCAAAACTGAGGAAGGGGGTGTAAACTGTAAAGGGGTTAT
                      ____________________________________________________________
consensus TACAAGACAGGGTACAGAATTCAAAACTGAGGAAGGGGGTGTAAACTGTAAAGGGGTTAT
 
. : . : . : . : . : . :
rJMSF046A02+ TCTTGCTGTTGTAAATACACCATATCTCTTCTCTTCAGAACTTTTACAATGGCTTTGAAA
rJMSF049O20+ TCTTGCTGTTGTAAATACACCATATCTCTTCTCTTCAGAACTTTTACAATGGCTTTGAAA
rJMFF001K22+ TCTNGCCGTTGTAAATACNCCATATCTCTTCTCTTCAGAACTTTTACAATGGCTTTGAAA
rJMFF001G16+ TCTTGCTGTTGTAAATACACCATATCTCTTCTCTTCAGAACTTTTACAATGGCTTTGAAA
rJMFF045F11+ TCTTGCTGTTGTAAATACACCATATCTCTTCTCTTCAGAACTTTTACAATGGCTTTGAAA
                      ____________________________________________________________
consensus TCTTGCTGTTGTAAATACACCATATCTCTTCTCTTCAGAACTTTTACAATGGCTTTGAAA
 
. : . : . : . : . : . :
rJMSF046A02+ CTTAGAAGATATGTAATTCCAATAGAATTTCATTACTCTGAGAATGAGAGATTTTCATTG
rJMSF049O20+ CTTAGAAGATATGTAATTCCAATAGAATTTCATTACTCTGAGAATGAGAGATTTTCATTG
rJMFF001K22+ CNTAGNAGATATGTAATTCCAATAGAATTTCATTACTCTGAGAATGAGAGATTTTCA
rJMFF001G16+ CTTAGAAGATATGTAATTCCAATAGAATTTCATTACTCTGAGAATGAGAGATTTTCATTG
rJMFF045F11+ CTTAGAAGATATGTAATTCCAATAGAATTTCATTACTCTGAGAATGAGAGATTTTCATTG
                      ____________________________________________________________
consensus CTTAGAAGATATGTAATTCCAATAGAATTTCATTACTCTGAGAATGAGAGATTTTCATTG
 
. : . : . : . : . : . :
rJMSF046A02+ ATGTTTTTTGAAATTGTAATTGCACCATGTAACTTAGAA
rJMSF049O20+ ATGTTTTTTGAAATTGTAATTGCACCATGTAACTTAGAA
rJMFF001G16+ ATGTTTTTTGAAATTGTAATTGCACCATGTAACTTAGAAGAT
rJMFF045F11+ ATGTTTTTTGAAATTGTAATTGCACCATGTAACTTAGAAGATTGATAATTTAATAATGAT
                      ____________________________________________________________
consensus ATGTTTTTTGAAATTGTAATTGCACCATGTAACTTAGAAGATTGATAATTTAATAATGAT
 
. : . : . : . : . : . :
rJMFF045F11+ GAGGGGGAGTTGTTATCCCAAAAAAAAAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus GAGGGGGAGTTGTTATCCCAAAAAAAAAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGT