Previous Contig 010520:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038K22Sequence559001665 (2)gb:BT005498_16384384e-34Arabidopsis thaliana clone U51370 putative UVB-resistance protein UVR8 (At5g0871730010520 (2)gb:BT005498_16384382e-54Arabidopsis thaliana clone U51370 putative UVB-resistance protein UVR8 (At5g0871
JMFF045E22Sequence613001665 (2)gb:BT005498_16384382e-44Arabidopsis thaliana clone U51370 putative UVB-resistance protein UVR8 (At5g0871660010520 (2)gb:BT005498_16384385e-30Arabidopsis thaliana clone U51370 putative UVB-resistance protein UVR8 (At5g0871

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038K22+ TGTGGCGGTTATCACA
                      ____________________________________________________________
consensus TGTGGCGGTTATCACA
 
. : . : . : . : . : . :
rJMFF038K22+ CATGTGTTGTTACAAGTGGTGGAGAGCTGTATACATGGGGCTCTAATGAAAATGGTTGTC
                      ____________________________________________________________
consensus CATGTGTTGTTACAAGTGGTGGAGAGCTGTATACATGGGGCTCTAATGAAAATGGTTGTC
 
. : . : . : . : . : . :
rJMFF038K22+ TTGGAACTGGTTGTACAGATGTTACTCATTCACCTGAAAGAGTCCAAGGTCCATTATTGA
                      ____________________________________________________________
consensus TTGGAACTGGTTGTACAGATGTTACTCATTCACCTGAAAGAGTCCAAGGTCCATTATTGA
 
. : . : . : . : . : . :
rJMFF038K22+ GAGATCCTGTTTCCAAGGTATCTTGTGGTTGGAAACACACAGCAGCAATTTCTGGAGGCA
rJMFF045E22+ GAGATCCTGTTTCCAAGGTATCTTGTGGTTGGAAACACACAGCAGCAATTTCTGGAGGCA
                      ____________________________________________________________
consensus GAGATCCTGTTTCCAAGGTATCTTGTGGTTGGAAACACACAGCAGCAATTTCTGGAGGCA
 
. : . : . : . : . : . :
rJMFF038K22+ ATGTTTATACATGGGGATGGGGAGGTTCCCACGGAACATTTTCTGAAGATGGGCATTCTT
rJMFF045E22+ ATGTTTATACGTGGGGATGGGGAGGTTCCCACGGAACATTTTCTGAAGATGGGCATTCTT
                      ____________________________________________________________
consensus ATGTTTATACGTGGGGATGGGGAGGTTCCCACGGAACATTTTCTGAAGATGGGCATTCTT
 
. : . : . : . : . : . :
rJMFF038K22+ CGGGTGGACAATTGGGCCAAGGAAACGATGTTGACCACATAGAGCCTACAATGGTTAACT
rJMFF045E22+ CGGGTGGACAATTGGGCCAAGGAAACGATGTTGACCACATAGAGCCTACAATGGTTAACT
                      ____________________________________________________________
consensus CGGGTGGACAATTGGGCCAAGGAAACGATGTTGACCACATAGAGCCTACAATGGTTAACT
 
. : . : . : . : . : . :
rJMFF038K22+ TTGAGATTGGTGCAAGAGCATTGCAAATATCTTGTGGATTCAATCATACGGGTGCTATAC
rJMFF045E22+ TTGAGATTGGTGCAAGAGCATTGCAAATATCTTGTGGATTCAATCATACGGGTGCTATAC
                      ____________________________________________________________
consensus TTGAGATTGGTGCAAGAGCATTGCAAATATCTTGTGGATTCAATCATACGGGTGCTATAC
 
. : . : . : . : . : . :
rJMFF038K22+ TTGAATATACATGAATAACACACCATTCTTATTACAAGTCTTAGAGAAACAGGTTTGAAG
rJMFF045E22+ TTGAATATACATGAATAACACACCATTCTTATTACAAGTCTTAGAGAAACAGGTTTGAAG
                      ____________________________________________________________
consensus TTGAATATACATGAATAACACACCATTCTTATTACAAGTCTTAGAGAAACAGGTTTGAAG
 
. : . : . : . : . : . :
rJMFF038K22+ AGTGCTGATCATATTGATTTTCTTCTTCAATCAACCTATTTTATATGAAGACCATAGTAT
rJMFF045E22+ AGTGCTGATCATATTGATTTTCTTCTTCAATCAACCTATTTTATATGAAGACCATAGTAT
                      ____________________________________________________________
consensus AGTGCTGATCATATTGATTTTCTTCTTCAATCAACCTATTTTATATGAAGACCATAGTAT
 
. : . : . : . : . : . :
rJMFF038K22+ TTTTCAGACTTGATTGAATTTGGCGTGTTGTAGTTTATGTTCCTAGAAATTGCCATTAAT
rJMFF045E22+ TTTTCAGACTTGATTGAATTTGGCGTGTTGTAGTTTATGTTCCTAGAAATTGCCATTAAT
                      ____________________________________________________________
consensus TTTTCAGACTTGATTGAATTTGGCGTGTTGTAGTTTATGTTCCTAGAAATTGCCATTAAT
 
. : . : . : . : . : . :
rJMFF038K22+ AGTATACGGCGTAACTGTTATCATTAATGACATTAAGTGTGCCACACATTTATGGCAATG
rJMFF045E22+ AGTATACGGCGTAACTGTTATCATTAATGACATTAAGTGTGCCACACATTTATGGCAATG
                      ____________________________________________________________
consensus AGTATACGGCGTAACTGTTATCATTAATGACATTAAGTGTGCCACACATTTATGGCAATG
 
. : . : . : . : . : . :
rJMFF038K22+ TATCGTCTCATCCCGGGAAGTAAATTGTGGCTACATTTTAGCATCCAATAATGGCTCTCA
rJMFF045E22+ TATCGTCTCATCCCGGGAAGTAAATTGTGGCTACATTTTAGCATCCAATAATGGCTCTCA
                      ____________________________________________________________
consensus TATCGTCTCATCCCGGGAAGTAAATTGTGGCTACATTTTAGCATCCAATAATGGCTCTCA
 
. : . : . : . : . : . :
rJMFF038K22+ TCAAATCTTACAACTTTTATCAGCCAAATTTTCGCGAGTCGGATAAGAAAATTT
rJMFF045E22+ TCAAATCTTACAACTTTTATCAGCCAAATTTTCGCGAGTCGGATAAGAAAATTTTGGCTG
                      ____________________________________________________________
consensus TCAAATCTTACAACTTTTATCAGCCAAATTTTCGCGAGTCGGATAAGAAAATTTTGGCTG
 
. : . : . : . : . : . :
rJMFF045E22+ TTATAATATATGGGCTTAATAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTATAATATATGGGCTTAATAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG