Previous Contig 010517:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022L12Sequence772010517 (8)gb:AY056242_15635633e-56Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMFF039H02Sequence522007886 (7)gb:AY054666_15633203e-36Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D763010517 (8)gb:AY054666_15633207e-46Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D
JMFF045E17Sequence628007886 (7)gb:AY054666_15633205e-50Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D582010517 (8)gb:AY056242_15635632e-26Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMSF002O12Sequence245007886 (7)760010517 (8)gb:AY056242_15635634e-56Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMSF017J01Sequence436007886 (7)gb:AY054666_15633201e-16Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D754010517 (8)gb:AY056242_15635632e-52Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMSF032K14Sequence666007886 (7)gb:AY054666_15633203e-57Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D616010517 (8)gb:AY054666_15633202e-43Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D
JMSF046E03Sequence664007886 (7)gb:AY054666_15633205e-54Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D642010517 (8)gb:AY054666_15633204e-47Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D
JMSF049A20Sequence702007886 (7)gb:AY054666_15633202e-54Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D775010517 (8)gb:AY056242_15635636e-40Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017J01+ CTGTAAAGAAGTGGTACCTGACTCC
                      ____________________________________________________________
consensus CTGTAAAGAAGTGGTACCTGACTCC
 
. : . : . : . : . : . :
rJMSF046E03+ ATTTGGCAGCATATTTATTGAGATGTA-
rJMSF032K14+ TGAGATGTA-
rJMSF017J01+ TTCGGTAGTCTCCATGATGGGCGGCTTGCTTCCATTGGCAGCATATTTATTGAGATGTA-
rJMFF039H02+ TTGGCAGCATATTTATTGAGATGTAC
                      ____________________________________________________________
consensus TTCGGTAGTCTCCATGATGGGCGGCTTGCTTCCTTTGGCAGCATATTTATTGAGATGTA-
 
. : . : . : . : . : . :
rJMSF046E03+ CTTTGTCTTCACATCCTTTTGGGAATTACAAAGGTGTACTATGTCTATGGATTTATGCTT
rJMSF032K14+ CTTTGTCTTCACATCCTTTT-GGAATTACAANGGTGTACTATGTCTATGGATTTATGCTT
rJMSF017J01+ CTTTGTCTTCACATCCTTTT-GGAATTACAA-GGTGTACTATGTCTATGGATTTATGCTT
rJMFF022L12+ A-GGTGTACTATGTCTATGGATTTATGCTT
rJMSF049A20+ A-GGTGTACTATGTCTATGGATTTATGCTT
rJMSF002O12+ A-GGTGTACTATGTCTATGGATTTATGCTT
rJMFF039H02+ CTTTGTCTTCACATCCTTTT-GGAATTACAA-GGTGTACTATGTCTATGGATTTATGCTT
                      ____________________________________________________________
consensus CTTTGTCTTCACATCCTTTT-GGAATTACAA-GGTGTACTATGTCTATGGATTTATGCTT
 
. : . : . : . : . : . :
rJMSF046E03+ CTGGTTTTCCTGATTCTCATCATTGTTACTGTTTGTGTGACGATCGTGGGAACATATTTC
rJMSF032K14+ CTGGTTTTCCTGATTCTCATCATTGTTACTGTTTGTGTGACGATCGTGGGAACATATTTC
rJMSF017J01+ CTGGTTTTCCTGATTCTCATCATTGTTACTGTTTGTGTGACGATCGTGGGAACATATTTC
rJMFF022L12+ CTGGTTTTCCTGATTCTCATCATTGTTACTGTTTGTGTGACGATCGTGGGAACATATTTC
rJMSF049A20+ CTGGTTTTCCTGATTCTCATCATTGTTACTGTTTGTGTGACGATCGTGGGAACATATTTC
rJMSF002O12+ CTGGTTTTCCTGATTCTCATCATTGTTACTGTTTGTGTGACGATCGTGGGAACATATTTC
rJMFF039H02+ CTGGTTTTCCTGATTCTCATCATTGTTACTGTTGGTGTGACGATCGTGGGAACATATTTC
                      ____________________________________________________________
consensus CTGGTTTTCCTGATTCTCATCATTGTTACTGTTTGTGTGACGATCGTGGGAACATATTTC
 
. : . : . : . : . : . :
rJMSF046E03+ TTGCTAAATGCTGAGAATTATCATTGGCAGTGGACTTCATTCTTCTCAGCTGCTTCTACA
rJMSF032K14+ TTGCTAAATGCTGAGAATTATCATTGGCAGTGGACTTCATTCTTCTCAGCTGCTTCTACA
rJMSF017J01+ TTGCTAAATGCTGAGAATTATCATTGGCAGTGGACTTCATTCTTCTCAGCTGCTTCTACA
rJMFF022L12+ TTGCTAAATGCTGAGAATTATCATTGGCAGTGGACTTCATTCTTCTCAGCTGCTTCTACA
rJMSF049A20+ TTGCTAAATGCTGAGAATTATCATTGGCAGTGGACTTCATTCTTCTCAGCTGCTTCTACA
rJMSF002O12+ TTGCTAAATGCTGAGAATTATCATTGGCAGTGGACTTCATTCTTCTCAGCTGCTTCTACA
rJMFF039H02+ TTGCTAAATGCTGAGAATTATCATTGGCAGTGGACTTCATTCTTCTCAGCTGCTTCTACA
                      ____________________________________________________________
consensus TTGCTAAATGCTGAGAATTATCATTGGCAGTGGACTTCATTCTTCTCAGCTGCTTCTACA
 
. : . : . : . : . : . :
rJMSF046E03+ GCTGTCTATGTATACTTGTACTCTATATATTACTACTATGTGAAGACTAAGATGTCAGGG
rJMSF032K14+ GCTGTCTATGTATACTTGTACTCTATATATTACTACTATGTGAAGACTAAGATGTCAGGG
rJMSF017J01+ GCTGTCTATGTATACTTGTACTCTATATATTACTACTATGTGAAGACTAAGATGTCAGGG
rJMFF022L12+ GCTGTCTATGTATACTTGTACTCTATATATTACTACTATGTGAAGACTAAGATGTCAGGG
rJMSF049A20+ GCTGTCTATGTATACTTGTACTCTATATATTACTACTATGTGAAGACTAAGATGTCAGGG
rJMSF002O12+ GCTGTCTATGTATACTTGTACTCTATATATTACTACTATGTGAAGACTAAGGTGTCAGGG
rJMFF039H02+ GCTGTCTATGTATACTTGTACTCTATATATTACTACTATGTGAAGACTAAGATGTCAGGG
rJMFF045E17+ TACTCTATATATTACTACTATGTGAAGACTAAGATGTCAGGG
                      ____________________________________________________________
consensus GCTGTCTATGTATACTTGTACTCTATATATTACTACTATGTGAAGACTAAGATGTCAGGG
 
. : . : . : . : . : . :
rJMSF046E03+ TTCTTCCAAGTCAGCTTCTACTTTGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
rJMSF032K14+ TTCTTCCAAGTCAGCTTCTACTTTGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
rJMSF017J01+ TTCTTCCAAGTCAGCTTCTACTTTGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
rJMFF022L12+ TTCTTCCAAGTCAGCTTCTACTTTGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
rJMSF049A20+ TTCTTCCAAGTCAGCTTCTACTTTGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
rJMSF002O12+ TTCTTCCAAGTCAGCTTCTACTTNGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
rJMFF039H02+ TTCTTCCAAGTCAGCTTCTACTTTGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
rJMFF045E17+ TTCTTCCAAGTCAGCTTCTACTTGGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
                      ____________________________________________________________
consensus TTCTTCCAAGTCAGCTTCTACTTTGGATACACACTGATGTTTTGTCTGGGCTTAGGAATC
 
. : . : . : . : . : . :
rJMSF046E03+ CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
rJMSF032K14+ CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
rJMSF017J01+ CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
rJMFF022L12+ CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
rJMSF049A20+ CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
rJMSF002O12+ CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
rJMFF039H02+ CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
rJMFF045E17+ CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
                      ____________________________________________________________
consensus CTTTGCGGGGCTGTTGGTTTTCTTGGCTCAAATCTGTTCGTGAGGAGGATCTACCGAAAC
 
. : . : . : . : . : . :
rJMSF046E03+ ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
rJMSF032K14+ ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
rJMSF017J01+ ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
rJMFF022L12+ ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
rJMSF049A20+ ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
rJMSF002O12+ ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
rJMFF039H02+ ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
rJMFF045E17+ ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
                      ____________________________________________________________
consensus ATCAAATGTGACTAATATTTGTTACGAGGTCTGATTCAGTGCTCTTATTCTGGCAACAAG
 
. : . : . : . : . : . :
rJMSF046E03+ TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
rJMSF032K14+ TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
rJMSF017J01+ TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
rJMFF022L12+ TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
rJMSF049A20+ TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
rJMSF002O12+ TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
rJMFF039H02+ TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
rJMFF045E17+ TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
                      ____________________________________________________________
consensus TCAGAAAAATTCGAGAATCTATTCAAGTATTGGGCACTGGTAATGTTTCAGCTGGATGTT
 
. : . : . : . : . : . :
rJMSF046E03+ CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
rJMSF032K14+ CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
rJMSF017J01+ CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
rJMFF022L12+ CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
rJMSF049A20+ CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
rJMSF002O12+ CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
rJMFF039H02+ CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
rJMFF045E17+ CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
                      ____________________________________________________________
consensus CAGATTTTGTCAGTGGTATGTACCTCTTTTGATTGTGGGGAAGGCCCGAGAATTTTCCCT
 
. : . : . : . : . : . :
rJMSF046E03+ CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATCA
rJMSF032K14+ CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATTA
rJMSF017J01+ CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATTA
rJMFF022L12+ CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATTA
rJMSF049A20+ CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATTA
rJMSF002O12+ CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATTA
rJMFF039H02+ CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATTA
rJMFF045E17+ CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATTA
                      ____________________________________________________________
consensus CTTCCCCAGGATGTAAAAACATAATTTTCGTAGTTTAGAATGCAGAGATTACTGTTATTA
 
. : . : . : . : . : . :
rJMSF046E03+ TCTGAGGCT
rJMSF032K14+ TCTGA
rJMSF017J01+ TCTGAGGCTAGCACAATACCAGCTTCACTTGGCATGTAGTATATCAATAGCCTCGCCTGC
rJMFF022L12+ TCTGAGGCTAGCACAATACCAGCTTCACTTGGCATGTAGTATATCAATAGCCTCGCCTGC
rJMSF049A20+ TCTGAGGCTAGCACAATACCAGCTTCACTTGGCATGTAGTATATCAATAGCCTCGCCTGC
rJMSF002O12+ TCTGAGGCTAGCACAATACCAGCTTCACTTGGCATGTAGTATATCAATAGCCTCGCCTGC
rJMFF039H02+ TCTGAGGCTAGCACAATACCAGCTTCACTTGGCATGTAGTATATCAATAGCCTCGCCTGC
rJMFF045E17+ TCTGAGGCTAGCACAATACCAGCTTCACTTGGCATGTAGTATATCAATAGCCTCGCCTGC
                      ____________________________________________________________
consensus TCTGAGGCTAGCACAATACCAGCTTCACTTGGCATGTAGTATATCAATAGCCTCGCCTGC
 
. : . : . : . : . : . :
rJMSF017J01+ TCTACACAATGT
rJMFF022L12+ TCTACACAATGTTGTACTCTAACAGAATTGCTACCTCCTTTTTGTTTTCTATACCGATTC
rJMSF049A20+ TCTACACAATGTTGTACTCTAACAGAATTGCTACTTCCTTTT
rJMSF002O12+ TCTACACAATGTTGTACTCTAACAGAATTGCTACTTCCTTTT
rJMFF039H02+ TCTACACAATGTTGTACTCTAACAGAATTGCTACCTCCTTTTTGTTTTCTATACCGATTC
rJMFF045E17+ TCTACACAATGTTGTACTCTAACAGAATTGCTACCTCCTTTTTGTTTTCTATACCGATTC
                      ____________________________________________________________
consensus TCTACACAATGTTGTACTCTAACAGAATTGCTACCTCCTTTTTGTTTTCTATACCGATTC
 
. : . : . : . : . : . :
rJMFF022L12+ CCATG
rJMFF039H02+ CCATGCAAT
rJMFF045E17+ CCATGCAATTAGAAAGTTTTTTGGATCAGCXXXXXXXXXXXXXXXXXXXCTCTCCAGGGT
                      ____________________________________________________________
consensus CCATGCAATTAGAAAGTTTTTTGGATCAGCNNNNNNNNNNNNNNNNNNNCTCTCCAGGGT