Previous Contig 010516:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035H13Sequence588001568 (2)pir|T02585|T025854e-08hypothetical protein At2g39170 [imported] - Arabidopsis thaliana>gb:AC004697_153705010516 (2)
JMFF045E15Sequence640001568 (2)pir|T02585|T025854e-16hypothetical protein At2g39170 [imported] - Arabidopsis thaliana>gb:AC004697_153577010516 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035H13+ TAAG
                      ____________________________________________________________
consensus TAAG
 
. : . : . : . : . : . :
rJMFF035H13+ CAAAGAGCTAGCAACTTCAGGTGGACTCAAATTGAAACCCGAGAACATATTCAAGTGAAG
                      ____________________________________________________________
consensus CAAAGAGCTAGCAACTTCAGGTGGACTCAAATTGAAACCCGAGAACATATTCAAGTGAAG
 
. : . : . : . : . : . :
rJMFF035H13+ CGTGAGCCCTCGTTGTCTTCCCAAAACCAGGCTTCATCAGCTGCAGATGCAAGTTCTTCA
                      ____________________________________________________________
consensus CGTGAGCCCTCGTTGTCTTCCCAAAACCAGGCTTCATCAGCTGCAGATGCAAGTTCTTCA
 
. : . : . : . : . : . :
rJMFF035H13+ TCAACTATTGCCAAGACAGGCGTCGATGAGTTCCCCTTGCCGAGTCAAACAGCAGATGAA
rJMFF045E15+ CGATGAGTTCCCCTTGCCGAGTCAAACAGCAGATGAA
                      ____________________________________________________________
consensus TCAACTATTGCCAAGACAGGCGTCGATGAGTTCCCCTTGCCGAGTCAAACAGCAGATGAA
 
. : . : . : . : . : . :
rJMFF035H13+ GCGCTACACGAGTCACAGGTGAATCGGAGCTTGTCCCATGGTCAGTTGCTGTCTTTGTCA
rJMFF045E15+ GCGCTACACGAGTCACAGGTGAATCGGAGCTTGTCCCATGGTCAGTTGCTGTCTTTGTCA
                      ____________________________________________________________
consensus GCGCTACACGAGTCACAGGTGAATCGGAGCTTGTCCCATGGTCAGTTGCTGTCTTTGTCA
 
. : . : . : . : . : . :
rJMFF035H13+ AATAACTACGAGGAATTTAGGGCTAACAAGGAAGCAAAACTGGAAGAGTGGTTGGAAGGA
rJMFF045E15+ AATAACTACGAGGAATTTAGGGCTAACAAGGAAGCAAAACTGGAAGAGTGGTTGGAAGGA
                      ____________________________________________________________
consensus AATAACTACGAGGAATTTAGGGCTAACAAGGAAGCAAAACTGGAAGAGTGGTTGGAAGGA
 
. : . : . : . : . : . :
rJMFF035H13+ ACAGGTGATCAGCAAGATAGGACTGAATAACATGAAAATGCAAATAAACGGTCAGCGAAT
rJMFF045E15+ ACAGGTGATCAGCAAGATAGGACTGAATAACATGAAAATGCAAATAAACGGTCAGCGAAT
                      ____________________________________________________________
consensus ACAGGTGATCAGCAAGATAGGACTGAATAACATGAAAATGCAAATAAACGGTCAGCGAAT
 
. : . : . : . : . : . :
rJMFF035H13+ CAGGTCGCCCATGCTTTGGCTAAGGAAGCTATTTCTTTACCTGGCTATGTGGAATGGTTC
rJMFF045E15+ CAGGTCGCCCATGCTTTGGCTAAGGAAGCTATTTCTTTACCTGGCTATGTGGAATGGTTC
                      ____________________________________________________________
consensus CAGGTCGCCCATGCTTTGGCTAAGGAAGCTATTTCTTTACCTGGCTATGTGGAATGGTTC
 
. : . : . : . : . : . :
rJMFF035H13+ TATACTCCCCCTAACTTCATTGTGGATGTTTTGAATTTTGATGGTTCTAATTAATATAGT
rJMFF045E15+ TATACTCCCCCTAACTTCATTGTGGATGTTTTGAATTTTGATGGTTCTAATTAATATAGT
                      ____________________________________________________________
consensus TATACTCCCCCTAACTTCATTGTGGATGTTTTGAATTTTGATGGTTCTAATTAATATAGT
 
. : . : . : . : . : . :
rJMFF035H13+ TCTGTTACTTTCAAAAAAAACATGAGAAGCAGATGGGCTTCATTATTCTGGGCAACATAT
rJMFF045E15+ TCTGTTACTTTCAAAAAAAACATGAGAAGCAGATGGGCTTCATTATTCTGGGCAACATAT
                      ____________________________________________________________
consensus TCTGTTACTTTCAAAAAAAACATGAGAAGCAGATGGGCTTCATTATTCTGGGCAACATAT
 
. : . : . : . : . : . :
rJMFF035H13+ AATGCTTCATTGTGAAGGGCTCTATATGTATCATTGCTGGTTGACCCTTTGGAGCATAAT
rJMFF045E15+ AATGCTTCATTGTGAAGGGCTCTATATGTATCATTGCTGGTTGACCCTTTGGAGCATAAT
                      ____________________________________________________________
consensus AATGCTTCATTGTGAAGGGCTCTATATGTATCATTGCTGGTTGACCCTTTGGAGCATAAT
 
. : . : . : . : . : . :
rJMFF035H13+ AAATGCCAAAGTTAAAAAGAAAAGTCACAAGGGATGAAAAAGATTGTTGAATTTAGGGGA
rJMFF045E15+ AAATGCCAAAGTTAAAAAGAAAAGTCACAAGGGATGAAAAAGATTGTTGAATTTAGGGGA
                      ____________________________________________________________
consensus AAATGCCAAAGTTAAAAAGAAAAGTCACAAGGGATGAAAAAGATTGTTGAATTTAGGGGA
 
. : . : . : . : . : . :
rJMFF035H13+ CAAGATTGCATGTAATCCAAAATTAATTGATTTTACATAT
rJMFF045E15+ CAAGATTGCATGTAATCCAAAATTAATTGATTTTACATATTGTATTATGATTGTTCATCC
                      ____________________________________________________________
consensus CAAGATTGCATGTAATCCAAAATTAATTGATTTTACATATTGTATTATGATTGTTCATCC