Previous Contig 010508:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045D17Sequence647004636 (5)gb:NGU73203_16909566e-68Nicotiana glutinosa farnesyltransferase beta subunit mRNA, partial cds.605010508 (5)gb:NGU73203_16909561e-39Nicotiana glutinosa farnesyltransferase beta subunit mRNA, partial cds.
JMFF045N15Sequence647004636 (5)gb:NGU73203_16909564e-64Nicotiana glutinosa farnesyltransferase beta subunit mRNA, partial cds.578010508 (5)gb:NGU73203_16909562e-39Nicotiana glutinosa farnesyltransferase beta subunit mRNA, partial cds.
JMSF001H10Sequence481004636 (5)gb:NGU73203_16909561e-43Nicotiana glutinosa farnesyltransferase beta subunit mRNA, partial cds.683010508 (5)pir|T07605|T076058e-45protein farnesyltransferase (EC 2.5.1.-) beta chain - tomato>gb:U75644_1726440 L
JMSF004L07Sequence385004636 (5)gb:NGU73203_16909561e-26Nicotiana glutinosa farnesyltransferase beta subunit mRNA, partial cds.381010508 (5)gb:NGU73203_16909568e-35Nicotiana glutinosa farnesyltransferase beta subunit mRNA, partial cds.
JMSF033A16Sequence606004636 (5)gb:NGU73203_16909565e-45Nicotiana glutinosa farnesyltransferase beta subunit mRNA, partial cds.701010508 (5)pir|T07605|T076059e-58protein farnesyltransferase (EC 2.5.1.-) beta chain - tomato>gb:U75644_1726440 L

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033A16+ AGGAGTGGAAGGTGGATTCCAAGGGAGAACAAATAAGTTGGTAGATG
                      ____________________________________________________________
consensus AGGAGTGGAAGGTGGATTCCAAGGGAGAACAAATAAGTTGGTAGATG
 
. : . : . : . : . : . :
rJMSF033A16+ GNTGCTATTCATTTTGGCAGGGTGGAGTGGCTGCGATATTACAAAGATTGCATTTGAATG
rJMSF001H10+ TGGCAGGGTGGAGTGGCTGCGATATTACAAAGATTGCATTTGAATG
                      ____________________________________________________________
consensus GNTGCTATTCATTTTGGCAGGGTGGAGTGGCTGCGATATTACAAAGATTGCATTTGAATG
 
. : . : . : . : . : . :
rJMSF033A16+ CTATGGAGTGTGACTCTGTCACAGGGAGTGACCATGGTTCTGTTGCATCTAGTTCCTCTG
rJMSF001H10+ CTATGGAGTGTGACTCTGTCACAGGGAGTGACCATGGTTCTGTTGCATCTAGTTCCTCTG
                      ____________________________________________________________
consensus CTATGGAGTGTGACTCTGTCACAGGGAGTGACCATGGTTCTGTTGCATCTAGTTCCTCTG
 
. : . : . : . : . : . :
rJMSF033A16+ ATGGAGAAGACCACCTTGAAGGAACATCCACTCACACGGATGAATCTTTTCATCTCAGGC
rJMSF001H10+ ATGGAGAAGACCACCTTGAAGGAACATCCACTCACACGGATGAATCTTTTCATCTCAGGC
rJMFF045N15+ CAGGC
rJMFF045D17+ CAGGC
                      ____________________________________________________________
consensus ATGGAGAAGACCACCTTGAAGGAACATCCACTCACACGGATGAATCTTTTCATCTCAGGC
 
. : . : . : . : . : . :
rJMSF033A16+ AGGGAGCTGGACCAGGCCATGATGCTTTTGAACCAGTGAAGAACTTGAACAACATTGGTT
rJMSF001H10+ AGGGAGCTGGACCAGGCCATGATGCTTTTGAACCAGTGAAGAACTTGAACAACATTGGTT
rJMFF045N15+ AGGGAGCTGGACCAGGCCATGATGCTTTTGAACCAGTGAAGAACTTGAACAACATTGGTT
rJMFF045D17+ AGGGAGCTGGACCAGGCCATGATGCTTNTGAACCAGTGAAGAACTTGAACAACATTGGTT
                      ____________________________________________________________
consensus AGGGAGCTGGACCAGGCCATGATGCTTTTGAACCAGTGAAGAACTTGAACAACATTGGTT
 
. : . : . : . : . : . :
rJMSF033A16+ ATGAGTTTATCAATGGACATGCTTCTAGGAGACCTCTATTTGACAACCTAAATTTGCAAC
rJMSF001H10+ ATGAGTTTATCAATGGACATGCTTNTAGGAGACCTCTATTTGACAACCTAAATTTGCAAC
rJMFF045N15+ ATGAGTTTATCAATGGACATGCTTCTAGGAGACCTCTATTTGACAACCTAAATTTGCAAC
rJMSF004L07+ CTCTATTTGACAACCTAAATTTGCAAC
rJMFF045D17+ ATGAGTTTATCAATGGACATGCTTCTAGGAGACCTCTATTTGACAACCTAAATTTGCAAC
                      ____________________________________________________________
consensus ATGAGTTTATCAATGGACATGCTTCTAGGAGACCTCTATTTGACAACCTAAATTTGCAAC
 
. : . : . : . : . : . :
rJMSF033A16+ GCTACATCATACTTTGCTCACAGGTAGAGGGCGGTTTCAGGGACAAACCAGGGAAGGCCA
rJMSF001H10+ GCTACATCATACTTTGCTCACAGGTAGAGGGCGGTTTCAGGGACAAACCAGGGAAGGCCA
rJMFF045N15+ GCTACATCATACTTTGCTCACAGGTAGAGGGCGGTTTCAGGGACAAACCAGGGAAGGCCA
rJMSF004L07+ GCTACATCATACTTTGCTCACAGGTAGAGGGCGGTTTCAGGGACAAACCAGGGAAGGCCA
rJMFF045D17+ GCTACATCATACTTTGCTCACAGGTAGAGGGCGGTTTCAGGGACAAACCAGGGAAGGCCA
                      ____________________________________________________________
consensus GCTACATCATACTTTGCTCACAGGTAGAGGGCGGTTTCAGGGACAAACCAGGGAAGGCCA
 
. : . : . : . : . : . :
rJMSF033A16+ GAGATCACTACCATACATGTTACTGCCTGAGTGGTCTTTCGATTTCTCAGTATAGCTGTG
rJMSF001H10+ GAGATCACTACCATACATGTTACTGCCTGAGTGGTCTTTCGATTTCTCAGTATAGCTGTG
rJMFF045N15+ GAGATCACTACCATACATGTTACTGCCTGAGTGGTCTTTCGATTTCTCAGTATAGCTGTG
rJMSF004L07+ GAGATCACTACCATACATGTTACTGCCTGAGTGGTCTTTCGATTTCTCAGTATAGCTGTG
rJMFF045D17+ GAGATCACTACCATACATGTTACTGCCTGAGTGGTCTTTCGATTTCTCAGTATAGCTGTG
                      ____________________________________________________________
consensus GAGATCACTACCATACATGTTACTGCCTGAGTGGTCTTTCGATTTCTCAGTATAGCTGTG
 
. : . : . : . : . : . :
rJMSF033A16+ CAAGTGATTTTGGCACTCCGCCTTTGCCCCGGGACATCTTGGGTCCTTATTCCAACAACC
rJMSF001H10+ CAAGTGATTTTGGCACTCCGCCTTTGCCCCGGGACATCTTGGGTCCTTATTCCAACAACC
rJMFF045N15+ CAAGTGATTTTGGCACTCCGCCTTTGCCCCGGGACATCTTGGGTCCTTATTCCAACAACC
rJMSF004L07+ CAAGTGATTTTGGCACTCCGCCTTTGCCCCGGGACATCTTGGGTCCTTATTCCAACAACC
rJMFF045D17+ CAAGTGATTTTGGCACTCCGCCTTTGCCCCGGGACATCTTGGGTCCTTATTCCAACAACC
                      ____________________________________________________________
consensus CAAGTGATTTTGGCACTCCGCCTTTGCCCCGGGACATCTTGGGTCCTTATTCCAACAACC
 
. : . : . : . : . : . :
rJMSF033A16+ TAGTCGAACGGATTCACCCTCTATTCAACATTGTCATAGATTGTTACTATGAGGCTCGTG
rJMSF001H10+ TAGTCGAACGGATTCACCCTCTATTCAACATTGTCATAGATTGTTACTATGAGGCTCGTG
rJMFF045N15+ TAGTCGAACGGATTCACCCTCTATTCAACATTGTCATAGATTGTTACTATGAGGCTCGTG
rJMSF004L07+ TAGTCGAACGGATTCACCCTCTATTCAACATTGTCATAGATTGTTACTATGAGGCTCGTG
rJMFF045D17+ TAGTCGAACGGATTCACCCTCTATTCAACATTGTCATAGATTGTTACTATGAGGCTCGTG
                      ____________________________________________________________
consensus TAGTCGAACGGATTCACCCTCTATTCAACATTGTCATAGATTGTTACTATGAGGCTCGTG
 
. : . : . : . : . : . :
rJMSF033A16+ AATTCTTCTCAGGTCTGTGAGGATCTTTTCCCTTTTTTTTTGTACCATAACATGTACTCC
rJMSF001H10+ AATTNTTCTCAGGTCTGTGAGGATCTTTTCCCTTTTTTTTTGTACCATAACATGTACTCC
rJMFF045N15+ AATTCTTCTCAGGTCTGTGAGGATCTTTTCCCTTTTTTTTTGTACCATAACATGTACTCC
rJMSF004L07+ AATTCTTCTCAGGTCTGTGAGGATCTTTTCCCTTTTTTTTTGTACCATAACATGTACTCC
rJMFF045D17+ AATTCTTCTCAGGTCTGTGAGGATCTTTTCCCTTTTTTTTTGTACCATAACATGTACTCC
                      ____________________________________________________________
consensus AATTCTTCTCAGGTCTGTGAGGATCTTTTCCCTTTTTTTTTGTACCATAACATGTACTCC
 
. : . : . : . : . : . :
rJMSF033A16+ GTACAATGGTTTCCCTCCAGTGTCCTTCCACAGCAGCGCCGTGAGGGAAGGATT
rJMSF001H10+ GTACAATGGTTTCCCTCCAGTGTCCTTCCACAGCAGCGCCGTGAGGGAAGGATTTGCAGT
rJMFF045N15+ GTACAATGGTTTCCCTCCAGTGTCCTTCCACAGCAGCGCCGTGAGGGAAGGATTTGCAGT
rJMSF004L07+ GTACAATGGTTTCCCTCCAGTGTCCTTCCACAGCAGCGCCGTGAGGGAAGGATT
rJMFF045D17+ GTACAATGGTTTCCCTCCAGTGTCCTTCCACAGCAGCGCCGTGAGGGAAGGATTTGCAGT
                      ____________________________________________________________
consensus GTACAATGGTTTCCCTCCAGTGTCCTTCCACAGCAGCGCCGTGAGGGAAGGATTTGCAGT
 
. : . : . : . : . : . :
rJMSF001H10+ GTTTATTATAGTGAAATTACTTGTTCGAAATCCTTCC
rJMFF045N15+ GTTTATTATAGTGAAATTACTTGTTCGAAATCCTTCCTATATATATTTTTTTTTCCATCA
rJMFF045D17+ GTTTATTATAGTGAAATTACTTGTTCGAAATCCTTCCTATATATATTTTTTTTTCCATCA
                      ____________________________________________________________
consensus GTTTATTATAGTGAAATTACTTGTTCGAAATCCTTCCTATATATATTTTTTTTTCCATCA
 
. : . : . : . : . : . :
rJMFF045N15+ AATTATAGGCGCCGTACTACATCTTTTTGTGCC
rJMFF045D17+ AATAATAGGCGCCGTACTACATCTTTTTGTGCCAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus AATTATAGGCGCCGTACTACATCTTTTTGTGCCAAAAAAAAAAAAAAAACTCTCCAGGGT