Previous Contig 010499:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045C03Sequence597010499 (4)sp|Q9M376|V727_ARATH2e-55Vesicle-associated membrane protein 727 (AtVAMP727).>pir|T47589|T47589 synaptobr448010499 (4)sp|Q9M376|V727_ARATH2e-17Vesicle-associated membrane protein 727 (AtVAMP727).>pir|T47589|T47589 synaptobr
JMSF045I02Sequence720010499 (4)sp|Q9M376|V727_ARATH6e-83Vesicle-associated membrane protein 727 (AtVAMP727).>pir|T47589|T47589 synaptobr736010499 (4)sp|Q9M376|V727_ARATH1e-90Vesicle-associated membrane protein 727 (AtVAMP727).>pir|T47589|T47589 synaptobr

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045C03- CGAGAACCGATTCGTCCCCGGT
JMSF045I02- GTCCCCGGT
                      ____________________________________________________________
consensus CGAGAACCGATTCGTCCCCGGT
 
. : . : . : . : . : . :
JMFF045C03- GACTTCTTCTCTGCACCATCCGGAGCAAATTCGCAAGTCTCGCACGCATCTTCCACTTCA
JMSF045I02- GACTTCTTCTCTGCACCATCCGGAGCAAATTCGCAAGTCTCGCACGCATCTTCCACTTCA
                      ____________________________________________________________
consensus GACTTCTTCTCTGCACCATCCGGAGCAAATTCGCAAGTCTCGCACGCATCTTCCACTTCA
 
. : . : . : . : . : . :
JMFF045C03- CCACGAACCAATCGCCGTTTCTGCAAATCTCAGGGGGTGCTTAATTGATTCTTGTCTTGG
JMSF045I02- CCACGAACCAATCGCCGTTTCTGCAAATCTCAGGGGGTGCTTAATTGATTCTTGTCTTGG
                      ____________________________________________________________
consensus CCACGAACCAATCGCCGTTTCTGCAAATCTCAGGGGGTGCTTAATTGATTCTTGTCTTGG
 
. : . : . : . : . : . :
JMFF045C03- ATTTGACATTGGATTTATTATAGAGAGATGAACCCAAAAGGCTTGATTTATAGCTTTGTT
JMSF045I02- ATTTGACATTGGATTTATTATAGAGAGATGAACCCAAAAGGCTTGATTTATAGCTTTGTT
                      ____________________________________________________________
consensus ATTTGACATTGGATTTATTATAGAGAGATGAACCCAAAAGGCTTGATTTATAGCTTTGTT
 
. : . : . : . : . : . :
JMFF045C03- GCAAAAGGCACTGTTGTTCTAGCGGAGTACACGCCTTATTCTGGGAACTTCAGCACCATT
JMSF045I02- GCAAAAGGCACTGTTGTTCTAGCGGAGTACACGCCTTATTCTGGGAACTTCAGCACCATT
rJMSF045I02+ TCAGCACCATT
                      ____________________________________________________________
consensus GCAAAAGGCACTGTTGTTCTAGCGGAGTACACGCCTTATTCTGGGAACTTCAGCACCATT
 
. : . : . : . : . : . :
JMFF045C03- GCTGTTCAGTGTTTGCAGAAGCTGCCTTCTAGTAGCAGCAAGTATACCTACTCATGTGAT
JMSF045I02- GCTGTTCAGTGTTTGCAGAAGCTGCCTTCTAGTAGCAGCAAGTATACCTACTCATGTGAT
rJMSF045I02+ GCTGTTCAGTGTTTGCAGAAGCTGCCTTCTAGTAGCAGCAAGTATACCTACTCATGTGAT
                      ____________________________________________________________
consensus GCTGTTCAGTGTTTGCAGAAGCTGCCTTCTAGTAGCAGCAAGTATACCTACTCATGTGAT
 
. : . : . : . : . : . :
JMFF045C03- GGGCATACTTTCAACTTCCTCCTTGACAGTGGTTTTGTCTTTCTTGTTGTTGCTGATGAA
JMSF045I02- GGGCATACTTTCAACTTCCTCCTTGACAGTGGTTTTGTCTTTCTTGTTGTTGCTGATGAA
rJMSF045I02+ GGGCATACTTTCAACTTCCTCCTTGACAGTGGTTTTGTCTTTCTTGTTGTTGCTGATGAA
                      ____________________________________________________________
consensus GGGCATACTTTCAACTTCCTCCTTGACAGTGGTTTTGTCTTTCTTGTTGTTGCTGATGAA
 
. : . : . : . : . : . :
JMFF045C03- TCAACGGGAAGAAATGTACCTTTTGTTTTCCTTGAGAAAGTGAAGGATGACTTCAAACAG
JMSF045I02- TCAACGGGAAGAAATGTACCTTTTGTTTTCCTTGAGAAAGTGAAGGATGACTTCAAACAG
rJMSF045I02+ TCAACGGGAAGAAATGTACCTTTTGTTTTCCTTGAGAAAGTGAAGGATGACTTCAAACAG
                      ____________________________________________________________
consensus TCAACGGGAAGAAATGTACCTTTTGTTTTCCTTGAGAAAGTGAAGGATGACTTCAAACAG
 
. : . : . : . : . : . :
JMFF045C03- CGTTATGGTGCTAGTATAAAAAGTGATGGTCCACACCCTCTTGCTGATGATGATGATGAA
JMSF045I02- CGTTATGGTGCTAGTATAAAAAGTGATGGTCCACACCCTCTTGCTGATGATGATGATGAA
rJMSF045I02+ CGTTATGGTGCTAGTATAAAAAGTGATGGTCCACACCCTCTTGCTGATGATGATGATGAA
                      ____________________________________________________________
consensus CGTTATGGTGCTAGTATAAAAAGTGATGGTCCACACCCTCTTGCTGATGATGATGATGAA
 
. : . : . : . : . : . :
JMFF045C03- GATGATGATCTATTTGAGGACCGGCTTTAGCCTTGCATACAATCTTGACCGACAATTTGG
JMSF045I02- GATGATGATCTATTTGAGGACCGG-TTTAGCATTGCATACAATCTTGACCGAGAATTTGG
rJMSF045I02+ GATGATGATCTATTTGAGGACCGG-TTTAGCATTGCATACAATCTTGACCGAGAATTTGG
                      ____________________________________________________________
consensus GATGATGATCTATTTGAGGACCGG-TTTAGCATTGCATACAATCTTGACCGAGAATTTGG
 
. : . : . : . : . : . :
JMFF045C03- GCCAAGGCTCAAAGAGCACATGCAGTATTGCATGA
JMSF045I02- GCCAAGGCTCAAAGAGCACATGCAGTATTGCATGAACCATCCAGATGAAATCAGCAAGCT
rJMSF045I02+ GCCAAGGCTCAAAGAGCACATGCAGTATTGCATGAACCATCCAGATGAAATCAGCAAGCT
                      ____________________________________________________________
consensus GCCAAGGCTCAAAGAGCACATGCAGTATTGCATGAACCATCCAGATGAAATCAGCAAGCT
 
. : . : . : . : . : . :
JMSF045I02- GTCTAAATTGAAGGCTCAAATAACAGAGGTTAAAGGAATAATGATGGACAACATTGAGAA
rJMSF045I02+ GTCTAAATTGAAGGCTCAAATAACAGAGGTTAAAGGAATAATGATGGACAACATTGAGAA
                      ____________________________________________________________
consensus GTCTAAATTGAAGGCTCAAATAACAGAGGTTAAAGGAATAATGATGGACAACATTGAGAA
 
. : . : . : . : . : . :
JMSF045I02- GGTTTTGGATAGGGGCGAGAGGATTGAATTGCTAGTTGATAAAACAGAAAA
rJMSF045I02+ GGTTTTGGATAGGGGCGAGAGGATTGAATTGCTAGTTGATAAAACAGAAAACCTTCAGTT
rJMFF045C03+ TAGTTGATAAAACAGAAAACCTTCAGTT
                      ____________________________________________________________
consensus GGTTTTGGATAGGGGCGAGAGGATTGAATTGCTAGTTGATAAAACAGAAAACCTTCAGTT
 
. : . : . : . : . : . :
rJMSF045I02+ TCAGGCTGACAGCTTTCAGAGGCAGGGGAGGCAACTACGCCGGAAGATGTGGCTGCAGAA
rJMFF045C03+ TCAGGCTGACAGCTTTCAGAGGCAGGGGAGGCAACTACGCCGGAAGATGTGGCTGCAGAA
                      ____________________________________________________________
consensus TCAGGCTGACAGCTTTCAGAGGCAGGGGAGGCAACTACGCCGGAAGATGTGGCTGCAGAA
 
. : . : . : . : . : . :
rJMSF045I02+ CCTTCAGATGAAGTTGATGGTTGGAGGAGGTGTCATTGCTGTAATTATGATCATCTGGCT
rJMFF045C03+ CCTTCAGATGAAGTTGATGGTTGGAGGAGGTGTCATTGCTGTAATTATGATCATCTGGCT
                      ____________________________________________________________
consensus CCTTCAGATGAAGTTGATGGTTGGAGGAGGTGTCATTGCTGTAATTATGATCATCTGGCT
 
. : . : . : . : . : . :
rJMSF045I02+ CATTGCTTGTGGAGGTTTCAAATGTTGAGGGTTTTAAACGGTGCGGTCTGGTATTTAGTA
rJMFF045C03+ CATTGCTTGTGGAGGTTTCAAATGTTGAGGGTTTTAAACGGTGCGGTCTGGTATTTAGTA
                      ____________________________________________________________
consensus CATTGCTTGTGGAGGTTTCAAATGTTGAGGGTTTTAAACGGTGCGGTCTGGTATTTAGTA
 
. : . : . : . : . : . :
rJMSF045I02+ TTCTACGAATTTGCTGGTCCTTTTTTGGCCTTTATTTCTTTTGATGTACAAAAACCATTA
rJMFF045C03+ TTTTACGAATTTGCTGGTCCTTTTTTGGCCTTTATTTCTTTTGATGTACAAAAACCATTA
                      ____________________________________________________________
consensus TTTTACGAATTTGCTGGTCCTTTTTTGGCCTTTATTTCTTTTGATGTACAAAAACCATTA
 
. : . : . : . : . : . :
rJMSF045I02+ GC
rJMFF045C03+ GCCCATTCTTGTATATGCTCTATACTTTAACTGGAACCTTGCGCCCAACTTCTTGCAAAC
                      ____________________________________________________________
consensus GCCCATTCTTGTATATGCTCTATACTTTAACTGGAACCTTGCGCCCAACTTCTTGCAAAC
 
. : . : . : . : . : . :
rJMFF045C03+ CCTGTTATTTCCCCTTGTAGTATTTTCTGCTCGCGTTCTTTATCTTTTATGGGGCATGAA
                      ____________________________________________________________
consensus CCTGTTATTTCCCCTTGTAGTATTTTCTGCTCGCGTTCTTTATCTTTTATGGGGCATGAA
 
. : . : . : . : . : . :
rJMFF045C03+ AACCCTGATAGCTATTGGATATTACTTCAACCAGTAAGTTAGACTGAAATGGCAGTGGTT
                      ____________________________________________________________
consensus AACCCTGATAGCTATTGGATATTACTTCAACCAGTAAGTTAGACTGAAATGGCAGTGGTT