Previous Contig 010497:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045B09Sequence645010497 (4)gb:AY372938_16033503e-47Mesembryanthemum crystallinum putative calcium-dependent protein kinase CPK1 ada650010497 (4)gb:AY372938_16033503e-40Mesembryanthemum crystallinum putative calcium-dependent protein kinase CPK1 ada
JMSF031I06Sequence665010497 (4)gb:AY372938_16033505e-50Mesembryanthemum crystallinum putative calcium-dependent protein kinase CPK1 ada786010497 (4)gb:AY372938_16033503e-64Mesembryanthemum crystallinum putative calcium-dependent protein kinase CPK1 ada

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045B09- GAGGGAGCTCTCTCTAC-AACGACCGGTGTTGGACTCGCAGTGTCGTCGTGGAT
JMSF031I06- GAGGGAGCTCTCTCTACAAACGACCGGTGTTGGACTCGCAGTGTCGTCGTGGAT
                      ____________________________________________________________
consensus GAGGGAGCTCTCTCTACAAACGACCGGTGTTGGACTCGCAGTGTCGTCGTGGAT
 
. : . : . : . : . : . :
JMFF045B09- TTCTTATACCCTTTTTCTCGATCGGAAGCTTCCAAGTTTCATCCAAGATTACAAGCTAGA
JMSF031I06- TTCTTATACCCTTTTTCTCGATCGGAAGCTTCCAAGTTTCATCCAAGATTACAAGCTAGA
                      ____________________________________________________________
consensus TTCTTATACCCTTTTTCTCGATCGGAAGCTTCCAAGTTTCATCCAAGATTACAAGCTAGA
 
. : . : . : . : . : . :
JMFF045B09- AAAGCTGGGATGGCGGGAGAGGATGGTATTGATATGTCAGCTCTGAAGTCCGAATTGACC
JMSF031I06- AAAGCTGGGATGGCGGGAGAGGATGGTATTGATATGTCAGCTCTGAAGTCCGAATTGACC
                      ____________________________________________________________
consensus AAAGCTGGGATGGCGGGAGAGGATGGTATTGATATGTCAGCTCTGAAGTCCGAATTGACC
 
. : . : . : . : . : . :
JMFF045B09- GAAACTGATATTAATTGGAAACAAGAAATGGAAAAGAGCCAGTGCGAGGTGGATGCATTG
JMSF031I06- GAAACTGATATTAATTGGAAACAAGAAATGGAAAAGAGCCAGTGCGAGGTGGATGCATTG
                      ____________________________________________________________
consensus GAAACTGATATTAATTGGAAACAAGAAATGGAAAAGAGCCAGTGCGAGGTGGATGCATTG
 
. : . : . : . : . : . :
JMFF045B09- CAAGCAAAACTTTTCGAGGTAAAAGATTGCACAAAGGATTCAGAAGAAGATGGAAAGAAG
JMSF031I06- CAAGCAAAACTTTTCGAGGTAAAAGATTGCACAAAGGATTCAGAAGAAGATGGAAAGAAG
                      ____________________________________________________________
consensus CAAGCAAAACTTTTCGAGGTAAAAGATTGCACAAAGGATTCAGAAGAAGATGGAAAGAAG
 
. : . : . : . : . : . :
JMFF045B09- GAGTTAGATGTTCTCTGGCGAAGAGTCAGAACTGCTGCAACATTGATGACACACTTGAAA
JMSF031I06- GAGTTAGATGTTCTCTGGCGAAGAGTCAGAACTGCTGCAACATTGATGACACACTTGAAA
                      ____________________________________________________________
consensus GAGTTAGATGTTCTCTGGCGAAGAGTCAGAACTGCTGCAACATTGATGACACACTTGAAA
 
. : . : . : . : . : . :
JMFF045B09- GTAAAAGCTAGAGTCCTTGCTGTTCCTCATTTGGCCCATATGATATGTGGTATCAAACAA
JMSF031I06- GTAAAAGCTAGAGTCCTTGCTGTTCCTCATTTGGCCCATATGATATGTGGTATCAAACAA
                      ____________________________________________________________
consensus GTAAAAGCTAGAGTCCTTGCTGTTCCTCATTTGGCCCATATGATATGTGGTATCAAACAA
 
. : . : . : . : . : . :
JMFF045B09- CTAGATGGAACGGGACTTGTTGACAGAAATGGCATTCCATTGCCGGGCTGGTCTAGGGAT
JMSF031I06- CTAGATGGAACGGGACTTGTTGACAGAAATGGCATTCCATTGCCGGGCTGGTCTAGGGAT
                      ____________________________________________________________
consensus CTAGATGGAACGGGACTTGTTGACAGAAATGGCATTCCATTGCCGGGCTGGTCTAGGGAT
 
. : . : . : . : . : . :
JMFF045B09- GTAGATCTACCCGCTTTTGATGATTCAGATGAGGAAGCATGGATTANACATTCTAGTGAA
JMSF031I06- GTAGATCTACCCGCTTTTGATGATTCAGATGAGGAAGCATGGATTAAACATTCTAGTGAA
                      ____________________________________________________________
consensus GTAGATCTACCCGCTTTTGATGATTCAGATGAGGAAGCATGGATTAAACATTCTAGTGAA
 
. : . : . : . : . : . :
JMFF045B09- CAAGGTTCTCTCCATGATCAAGATGGAGCTTATATTACTGAATTACTGAGGTGTGTACAG
JMSF031I06- CAAGGTTCTCTCCATGATCAAGATGGAGCTTATATTACTGAATTACTGAGGTGTGTACAG
rJMSF031I06+ TACTGNATTACTGAGGTGTGTACAG
                      ____________________________________________________________
consensus CAAGGTTCTCTCCATGATCAAGATGGAGCTTATATTACTGAATTACTGAGGTGTGTACAG
 
. : . : . : . : . : . :
JMFF045B09- ACAGTTACAGACGTTATGGAAAATCTTGTTAAGAGGGTTATACTGGCTGAAT
JMSF031I06- ACAGTTACAGACGTTATGGAAAATCTTGTTAAGAGGGTTATACTGGCTGAATCGGAGACT
rJMSF031I06+ ACAGTTACAGACGTTATGGAAAATCTTGTTAAGAGGGTTATACTGGCTGAATCGGAGACT
                      ____________________________________________________________
consensus ACAGTTACAGACGTTATGGAAAATCTTGTTAAGAGGGTTATACTGGCTGAATCGGAGACT
 
. : . : . : . : . : . :
JMSF031I06- GCTGTTGAGAA
rJMSF031I06+ GCTGTTGAGAAGAAGAAGGTGACTGTAGGTGAGGAAGAGATTAGAAAGAAGGCACTCGAA
                      ____________________________________________________________
consensus GCTGTTGAGAAGAAGAAGGTGACTGTAGGTGAGGAAGAGATTAGAAAGAAGGCACTCGAA
 
. : . : . : . : . : . :
rJMSF031I06+ ATTGAAAACATGTCTATTAAGTTAGAAGAGATGGAAAGATTTGCAATGGGTACAAACTGT
                      ____________________________________________________________
consensus ATTGAAAACATGTCTATTAAGTTAGAAGAGATGGAAAGATTTGCAATGGGTACAAACTGT
 
. : . : . : . : . : . :
rJMSF031I06+ ATCTTAAATGAGATGCGCCAGAGAGTTGAAGATTTAGTTGAAGAAACATCTCAACAGAGG
rJMFF045B09+ GAGATGCGCCAGAGAGTTGAAGATTTAGTTGAAGAAACATCTCAACAGAGG
                      ____________________________________________________________
consensus ATCTTAAATGAGATGCGCCAGAGAGTTGAAGATTTAGTTGAAGAAACATCTCAACAGAGG
 
. : . : . : . : . : . :
rJMSF031I06+ CAAAGAGCTGCAGAAAATGAGCAAGAGCTTTGTCGTGTTAAGCGAGACTTTGAATCTCTG
rJMFF045B09+ CAAAGAGCTGCAGAAAATGAGCAAGAGCTTNGTCGTGTTAAGCGAGACTTTGAATCTCTG
                      ____________________________________________________________
consensus CAAAGAGCTGCAGAAAATGAGCAAGAGCTTTGTCGTGTTAAGCGAGACTTTGAATCTCTG
 
. : . : . : . : . : . :
rJMSF031I06+ AAGACGTATGTTAATAGTCTTATTAGTGTGAGAGAAACACTCCTCTCATCAGAAAAGCAG
rJMFF045B09+ AAGACGTATGTTAATAGTCTTATTAGTGTGAGAGAAACACTCCTCTCATCAG-AAAGCAG
                      ____________________________________________________________
consensus AAGACGTATGTTAATAGTCTTATTAGTGTGAGAGAAACACTCCTCTCATCAGAAAAGCAG
 
. : . : . : . : . : . :
rJMSF031I06+ TTTCAGACAATTGAAAGGCTCTTTGAACGGCTGGTTGAGAAAACAACTCAGTTGGAGAGT
rJMFF045B09+ TTTCAGACAATTGAAAGGCTCTTTGAACGGCTGGTTGAGAAAACAACTCAGTTGGAGAGT
                      ____________________________________________________________
consensus TTTCAGACAATTGAAAGGCTCTTTGAACGGCTGGTTGAGAAAACAACTCAGTTGGAGAGT
 
. : . : . : . : . : . :
rJMSF031I06+ GAGAAGATGCAAAAAGAGGCCGAAGTACAGAAGCTTATGGAAGAGAATGTGAAGTTAACT
rJMFF045B09+ GAGAAGATGCAAAAAGAGGCCGAAGTACAGAAGCTTATGGAAGAGAATGTGAAGTTAACT
                      ____________________________________________________________
consensus GAGAAGATGCAAAAAGAGGCCGAAGTACAGAAGCTTATGGAAGAGAATGTGAAGTTAACT
 
. : . : . : . : . : . :
rJMSF031I06+ GCTTTACTTGACAAGAAAGAGGCCCAACTCCTAGCAATGAATGAACAATGCAAGGTTATG
rJMFF045B09+ GCTTTACTTGACAAGAAAGAGGCCCAACTCCTAGCAATGAATGAACAATGCAAGGTTATG
                      ____________________________________________________________
consensus GCTTTACTTGACAAGAAAGAGGCCCAACTCCTAGCAATGAATGAACAATGCAAGGTTATG
 
. : . : . : . : . : . :
rJMSF031I06+ GCACTGAGTGCTT
rJMFF045B09+ GCACTGAGTGCTTCTAATATCTAGTTTGACATGCTTATACAGATGCCATCTTTATCACAT
                      ____________________________________________________________
consensus GCACTGAGTGCTTCTAATATCTAGTTTGACATGCTTATACAGATGCCATCTTTATCACAT
 
. : . : . : . : . : . :
rJMFF045B09+ TGACCTCACCTTAACACCTGTTATCCTTCCAGAAGATTAAGGTGAGTTTAGCAGATGAAT
                      ____________________________________________________________
consensus TGACCTCACCTTAACACCTGTTATCCTTCCAGAAGATTAAGGTGAGTTTAGCAGATGAAT
 
. : . : . : . : . : . :
rJMFF045B09+ TCTGTTTTGGCTTCTGTTCTTGACTACAATCCAAGAGAACCCATTGCCTGTAATTGTGCT
                      ____________________________________________________________
consensus TCTGTTTTGGCTTCTGTTCTTGACTACAATCCAAGAGAACCCATTGCCTGTAATTGTGCT
 
. : . : . : . : . : . :
rJMFF045B09+ GTATTGGCTCATTGAGCGAAGTAATCCCATTAACTAGACACAATTGTACTTAAATCTAAT
                      ____________________________________________________________
consensus GTATTGGCTCATTGAGCGAAGTAATCCCATTAACTAGACACAATTGTACTTAAATCTAAT
 
. : . : . : . : . : . :
rJMFF045B09+ AGAAAATGTTGTTGCATCTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AGAAAATGTTGTTGCATCTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG