Previous Contig 010495:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007B14Sequence518006367 (53)sp|P07145|CATA_IPOBA3e-80Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>732010495 (46)sp|P07145|CATA_IPOBA2e-88Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF010G12Sequence539006367 (53)sp|P07145|CATA_IPOBA1e-83Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>650010495 (46)sp|P07145|CATA_IPOBA5e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF010J08Sequence578006367 (53)sp|P07145|CATA_IPOBA1e-92Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>747010495 (46)sp|P07145|CATA_IPOBA3e-99Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF012C13Sequence421006367 (53)sp|P07145|CATA_IPOBA8e-62Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>652010495 (46)sp|P07145|CATA_IPOBA2e-82Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF012G21Sequence558006367 (53)sp|P07145|CATA_IPOBA1e-88Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>739010495 (46)sp|P07145|CATA_IPOBA3e-99Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF012N13Sequence504006367 (53)sp|P07145|CATA_IPOBA8e-78Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>393010495 (46)sp|P07145|CATA_IPOBA6e-22Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF013J06Sequence575006367 (53)sp|P07145|CATA_IPOBA8e-87Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>721010495 (46)sp|P07145|CATA_IPOBA3e-99Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF013N15Sequence517006367 (53)sp|P07145|CATA_IPOBA3e-79Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>654010495 (46)sp|P07145|CATA_IPOBA2e-80Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF016G22Sequence578006367 (53)sp|P07145|CATA_IPOBA1e-92Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>739010495 (46)sp|P07145|CATA_IPOBA3e-99Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF016M08Sequence581006367 (53)sp|P07145|CATA_IPOBA3e-93Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>650010495 (46)sp|P07145|CATA_IPOBA1e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF016N06Sequence560006367 (53)sp|P07145|CATA_IPOBA1e-88Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>722010495 (46)sp|P07145|CATA_IPOBA6e-99Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF020E09Sequence579006367 (53)sp|P07145|CATA_IPOBA3e-93Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>641010495 (46)sp|P07145|CATA_IPOBA1e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF021C10Sequence522006367 (53)sp|P07145|CATA_IPOBA3e-80Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>651010495 (46)sp|P07145|CATA_IPOBA1e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF025O07Sequence517006367 (53)sp|P07145|CATA_IPOBA3e-80Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>644010495 (46)sp|P07145|CATA_IPOBA2e-80Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF028B08Sequence521006367 (53)sp|P07145|CATA_IPOBA7e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>615010495 (46)sp|P07145|CATA_IPOBA7e-73Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF028F10Sequence544006367 (53)sp|P07145|CATA_IPOBA3e-85Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>465010495 (46)sp|P07145|CATA_IPOBA9e-40Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF029M11Sequence523006367 (53)sp|P07145|CATA_IPOBA7e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>655010495 (46)sp|P07145|CATA_IPOBA1e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF031H12Sequence523006367 (53)sp|P07145|CATA_IPOBA7e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>117010495 (46)sp|P07145|CATA_IPOBA4e-08Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF033D20Sequence515006367 (53)sp|P07145|CATA_IPOBA2e-74Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>740010495 (46)sp|P07145|CATA_IPOBA3e-99Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF037B15Sequence521006367 (53)sp|P07145|CATA_IPOBA3e-77Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>647010495 (46)sp|P07145|CATA_IPOBA1e-78Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF039P07Sequence422006367 (53)sp|P07145|CATA_IPOBA8e-62Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>527010495 (46)sp|P07145|CATA_IPOBA3e-47Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF043I06Sequence636006367 (53)sp|P07145|CATA_IPOBAe-105Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>567010495 (46)sp|P07145|CATA_IPOBA3e-57Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF045B06Sequence635006367 (53)sp|P07145|CATA_IPOBAe-104Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>463010495 (46)sp|P07145|CATA_IPOBA1e-17Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF045J12Sequence608006367 (53)sp|P07145|CATA_IPOBA3e-99Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>594010495 (46)sp|P07145|CATA_IPOBA6e-80Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF048B12Sequence418006367 (53)sp|P07145|CATA_IPOBA3e-61Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>312010495 (46)sp|P07145|CATA_IPOBA0.004Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFF051O14Sequence549006367 (53)sp|P07145|CATA_IPOBA4e-79Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>552010495 (46)sp|P07145|CATA_IPOBA9e-47Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMFS019A12Sequence370010495 (46)sp|P07145|CATA_IPOBA3e-14Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF001C21Sequence224006367 (53)sp|P07145|CATA_IPOBA3e-22Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>649010495 (46)sp|P07145|CATA_IPOBA1e-81Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF006C20Sequence302004778 (4)pir|T38001|T380010.025probable phosphatidylinositol-4-phosphate 5-kinase - fission yeast (Schizosaccha236010495 (46)
JMSF009E21Sequence341006367 (53)sp|P07145|CATA_IPOBA4e-45Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>722010495 (46)sp|P07145|CATA_IPOBAe-100Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF009G13Sequence432006367 (53)sp|P07145|CATA_IPOBA2e-63Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>764010495 (46)sp|P07145|CATA_IPOBAe-108Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF010N01Sequence394018684747010495 (46)sp|P07145|CATA_IPOBA7e-94Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF016F08Sequence318006367 (53)sp|P07145|CATA_IPOBA2e-40Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>774010495 (46)sp|P07145|CATA_IPOBAe-110Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF018B07Sequence432006367 (53)sp|P07145|CATA_IPOBA2e-63Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>733010495 (46)sp|P07145|CATA_IPOBAe-103Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF018N23Sequence225006367 (53)sp|P07145|CATA_IPOBA8e-22Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>716010495 (46)sp|P07145|CATA_IPOBAe-101Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF024K21Sequence673006367 (53)sp|P07145|CATA_IPOBAe-113Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>724010495 (46)sp|P07145|CATA_IPOBAe-100Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF026F11Sequence645006367 (53)sp|P07145|CATA_IPOBA1e-93Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>775010495 (46)sp|P07145|CATA_IPOBAe-111Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF028F23Sequence669006367 (53)sp|P07145|CATA_IPOBAe-112Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>665010495 (46)sp|P07145|CATA_IPOBA2e-82Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF032E15Sequence721006367 (53)sp|P07145|CATA_IPOBAe-124Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>724010495 (46)sp|P07145|CATA_IPOBAe-100Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF032K13Sequence622006367 (53)sp|P07145|CATA_IPOBAe-102Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>715010495 (46)sp|P07145|CATA_IPOBAe-100Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF034C11Sequence652006367 (53)sp|P07145|CATA_IPOBAe-109Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>721010495 (46)sp|P07145|CATA_IPOBAe-100Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF041D07Sequence758006367 (53)sp|P07145|CATA_IPOBAe-129Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>600010495 (46)sp|P07145|CATA_IPOBA6e-72Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF045N05Sequence789006367 (53)sp|P07145|CATA_IPOBAe-138Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>718010495 (46)sp|P07145|CATA_IPOBA2e-95Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF045N12Sequence278006367 (53)sp|P07145|CATA_IPOBA1e-31Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>566010495 (46)sp|P07145|CATA_IPOBA1e-66Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF046A03Sequence584006367 (53)sp|P07145|CATA_IPOBA9e-94Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>588010495 (46)sp|P07145|CATA_IPOBA4e-70Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>
JMSF047F14Sequence712006367 (53)sp|P07145|CATA_IPOBAe-122Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>722010495 (46)sp|P07145|CATA_IPOBAe-101Catalase (EC 1.11.1.6).>pir|S07124|S07124 catalase (EC 1.11.1.6) - sweet potato>

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016F08+ TGCAGCCGGTGGGGCGGAT
rJMSF026F11+ CCTCTGCAGCCGGTGGGGCGGAT
rJMSF009G13+ GTGGGGCGGAT
                      ____________________________________________________________
consensus CCTCTGCAGCCGGTGGGGCGGAT
 
. : . : . : . : . : . :
rJMSF018B07+ ATCGACAACTTCTTCGCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF047F14+ CTTCGCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF018N23+ TTCGCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF032K13+ GAGAACGAGATGGTGGCCATGGACCC
rJMSF016F08+ GGTATTGAACAAGAACATCGACAACTTCTTCGCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF034C11+ GCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF032E15+ TTCGCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF026F11+ GGTATTGAACAAGAACATCGACAACTTCTTCGCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF045N05+ CGGAGAACGAGATGGTGGCCATGGACCC
rJMSF024K21+ TCGCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF009G13+ GGTATTGAACCAGAACATCGACAACTTCTTCGCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF009E21+ GCGGAGAACGAGATGGTGGCCATGGACCC
rJMSF010N01+ GGAGAACGAGATGGTGGCCATGGACCC
rJMFF033D20+ AGAACGAGATGGTGGCCATGGACCC
rJMFF012G21+ GAACGAGATGGTGGCCATGGACCC
rJMFF016G22+ GAACGAGATGGTGGCCATGGACCC
rJMFF013J06+ GAACGAGATGGTGGCCATGGACCC
rJMFF016N06+ GAACGAGATGGTGGCCATGGACCC
rJMFF010J08+ AGAACGAGATGGTGGCCATGGACCC
                      ____________________________________________________________
consensus GGTATTGAACAAGAACATCGACAACTTCTTCGCGGAGAACGAGATGGTGGCCATGGACCC
 
. : . : . : . : . : . :
rJMSF018B07+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF047F14+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF018N23+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF032K13+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF016F08+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF034C11+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF032E15+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF026F11+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF045N05+ GGCGCACATTGTTCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF024K21+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF009G13+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF009E21+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMSF010N01+ GGCGCACATTG-TCCCCGGAATATA-TTNTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMFF033D20+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMFF012G21+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMFF016G22+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMFF013J06+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMFF016N06+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMFF010J08+ GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
rJMFF007B14+ TCTCCGATGATAAGATGCTCCAGGCTAGAATNT
                      ____________________________________________________________
consensus GGCGCACATTG-TCCCCGGAATATATTTCTCCGATGATAAGATGCTCCAGGCTAGAATCT
 
. : . : . : . : . : . :
rJMSF018B07+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF047F14+ TCGCNTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF018N23+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF032K13+ TCGCNTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF016F08+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF034C11+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF032E15+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF026F11+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF045N05+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF024K21+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF046A03+ CCCGTT
rJMSF009G13+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF009E21+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF010N01+ TCGCNTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF033D20+ TCGCNTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF012G21+ TCGCNTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF016G22+ TCGCNTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF013J06+ TCGCNTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF016N06+ TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF010J08+ TCGCNTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF028F23+ TACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF029M11+ GCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF013N15+ ACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF021C10+ ACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF016M08+ ACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMSF001C21+ ACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF012C13+ TACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF010G12+ ACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF025O07+ CACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF020E09+ ACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF037B15+ CGACACTCNCCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
rJMFF028B08+ CTGCTT-CCCGTT
rJMSF041D07+ TATATGCTGCTTCCCCGTT
rJMFF045J12+ CACCGCCACCGCCTCGGCCCCAATTATATGCTGCTT-CCCGTT
rJMSF045N12+ TGCTT-CCCGTT
rJMFF007B14+ TCGCTTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
                      ____________________________________________________________
consensus TCGCCTACGCCGACACTCACCGCCACCGCCTCGGCCCCAACTATATGCTGCTT-CCCGTT
 
. : . : . : . : . : . :
rJMSF018B07+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF047F14+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF018N23+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF032K13+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF016F08+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF034C11+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF032E15+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF026F11+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF045N05+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF024K21+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF046A03+ AATGCCCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF009G13+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF009E21+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF010N01+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF033D20+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF012G21+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF016G22+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF013J06+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF016N06+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF010J08+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF028F23+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF029M11+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF013N15+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF021C10+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF016M08+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF001C21+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF012C13+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF010G12+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF025O07+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF020E09+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF037B15+ AATG-CCACCAAGTGTGNTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF028B08+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMSF041D07+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
rJMFF045J12+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGCTACATGAACTTTGTCCA
rJMSF045N12+ AATG-CCCCCAAGTGTGCTTATCACAACAANAGCTATGANGGTTACATGAACTTTGTCCA
rJMFF007B14+ AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
                      ____________________________________________________________
consensus AATG-CCCCCAAGTGTGCTTATCACAACAATAGCTATGATGGTTACATGAACTTTGTCCA
 
. : . : . : . : . : . :
rJMSF018B07+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF047F14+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF018N23+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF032K13+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF016F08+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF034C11+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF032E15+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF026F11+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF045N05+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF024K21+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF046A03+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF009G13+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF009E21+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF010N01+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF033D20+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF012G21+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF016G22+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF013J06+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF016N06+ CAGGGATGAACAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF010J08+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF028F23+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF029M11+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF013N15+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF021C10+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF016M08+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF001C21+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF012C13+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF010G12+ CAGGGATGAAGAGTTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF025O07+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF020E09+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF037B15+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF028B08+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMSF041D07+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF045J12+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF039P07+ CTTTCCCTCGAAGNTTGATANCACACGTANCGCTGAGAG
rJMSF045N12+ CAGGGANGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF028F10+ CAGGGATGAAGAGGTCGATTANTTTCCCTNGAAGTTNGATAACACANGTNNNGCTGAGAG
rJMFF007B14+ CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
rJMFF051O14+ CGTAACGCTGAGAG
rJMFF043I06+ AGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
                      ____________________________________________________________
consensus CAGGGATGAAGAGGTTGATTACTTTCCCTCGAAGTTTGATAACACACGTAACGCTGAGAG
 
. : . : . : . : . : . :
rJMSF018B07+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF047F14+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF018N23+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF032K13+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF016F08+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF034C11+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF032E15+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF026F11+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF045N05+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF024K21+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF046A03+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF009G13+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF009E21+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF010N01+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF033D20+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF012G21+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF016G22+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF013J06+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF016N06+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF010J08+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF028F23+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF029M11+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF013N15+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF021C10+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF016M08+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF001C21+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF012C13+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF010G12+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF025O07+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF020E09+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF037B15+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF028B08+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMSF041D07+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF045J12+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF039P07+ GTTCCCANCTCCGTTACGTATCGTGACGGGGCGACGTGATAAGNGNGTTATTGAGAAGGA
rJMSF045N12+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF028F10+ GTTCCCAANTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF007B14+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF051O14+ GTCNCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
rJMFF043I06+ GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
                      ____________________________________________________________
consensus GTTCCCAACTCCGTTACGTATCGTGACGGGGCGACGTGATAAGTGTGTTATTGAGAAGGA
 
. : . : . : . : . : . :
rJMSF018B07+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF047F14+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF018N23+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF032K13+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF016F08+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF034C11+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF032E15+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF026F11+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF045N05+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF024K21+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF046A03+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF009G13+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF009E21+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF010N01+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF033D20+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF012G21+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF016G22+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF013J06+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF016N06+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF010J08+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF028F23+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF029M11+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF013N15+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF021C10+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF016M08+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF001C21+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF012C13+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF010G12+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF025O07+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF020E09+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF037B15+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF028B08+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF041D07+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF045J12+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF039P07+ GAACANCTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMSF045N12+ GAACAACTTCAAGCAACCNGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF028F10+ GANCANCTTCAAGCAACNTGGAGATAGATNCAGATCCNGGGCTCCAGACAGGCAAGATAG
rJMFF031H12+ GGAGATAGATNCAGATCCTGGGNTCCAGNCAGNCAAGATAG
rJMFF007B14+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF051O14+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF043I06+ GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
rJMFF012N13+ GACAGGCAAGNTAG
                      ____________________________________________________________
consensus GAACAACTTCAAGCAACCTGGAGATAGATACAGATCCTGGGCTCCAGACAGGCAAGATAG
 
. : . : . : . : . : . :
rJMSF018B07+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF047F14+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF018N23+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF032K13+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF016F08+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF034C11+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF032E15+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAA
rJMSF026F11+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF045N05+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF024K21+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF046A03+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF009G13+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF009E21+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF010N01+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF033D20+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF012G21+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF016G22+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF013J06+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF016N06+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF010J08+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF028F23+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF029M11+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF013N15+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF021C10+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF016M08+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF001C21+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF012C13+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF010G12+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF025O07+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF020E09+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF037B15+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF028B08+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF041D07+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF045J12+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF039P07+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMSF045N12+ NTTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTNGCAG
rJMFF028F10+ ATTCATCAACCGATGGGTCAAGTCCTTGTNGGAGCCCCGAGTCNCCCANGAAATTNGCAG
rJMFF031H12+ ANTCATCANNNGANGGGTCAAGTCCTNNTCGGAGCCNCGAGTCACCCATGAAATTCGCAG
rJMFF007B14+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF051O14+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF043I06+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
JMFS019A12+ TGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF012N13+ ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
rJMFF045B06+ CGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
                      ____________________________________________________________
consensus ATTCATCAACCGATGGGTCAAGTCCTTGTCGGAGCCCCGAGTCACCCATGAAATTCGCAG
 
. : . : . : . : . : . :
rJMSF018B07+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF047F14+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF018N23+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF032K13+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF016F08+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF034C11+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF032E15+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF026F11+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF045N05+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF024K21+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF046A03+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF009G13+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF009E21+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF010N01+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF033D20+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF012G21+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF016G22+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF013J06+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF016N06+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF010J08+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF028F23+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF029M11+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF013N15+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF021C10+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF016M08+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF001C21+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF012C13+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF010G12+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF025O07+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF020E09+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF037B15+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF028B08+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF041D07+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF045J12+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF039P07+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMSF045N12+ CACCTGGATTTCATNCCTCACTCAGGNTGATAGGTCTCTNGGNCAAAAGGTAGCTTCCCG
rJMFF028F10+ CACCNGGATTTCATACCTCANTCAGNCTGATAGGTNTNNTGGACNAAAGGTAGCTTCCCN
rJMFF031H12+ CNCNTGGATTTCA
rJMFF007B14+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF051O14+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF043I06+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
JMFS019A12+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF048B12+ CTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
rJMFF012N13+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGNCAAAAGGTAGCTTCCCG
rJMFF045B06+ CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
                      ____________________________________________________________
consensus CACCTGGATTTCATACCTCACTCAGGCTGATAGGTCTCTTGGACAAAAGGTAGCTTCCCG
 
. : . : . : . : . : . :
rJMSF018B07+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF047F14+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF018N23+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF032K13+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF016F08+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF034C11+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF032E15+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF026F11+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF045N05+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF024K21+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF046A03+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF009G13+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF009E21+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF010N01+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF033D20+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF012G21+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF016G22+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF013J06+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF016N06+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF010J08+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF028F23+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF029M11+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF013N15+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF021C10+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF016M08+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF001C21+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF012C13+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF010G12+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF025O07+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF020E09+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF037B15+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF028B08+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF041D07+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF045J12+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF039P07+ CCTGAACATAAGACCANCTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMSF045N12+ CCTGAACATAAGACCAACTANGTAAGAGAGGTGGAAGGCAGTANAAATNGCTTTTGAGCT
rJMFF028F10+ CCTGAACATAAGACCANNTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTNTTGAGTT
rJMSF006C20+ AACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTCTGAGTT
rJMFF007B14+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF051O14+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF043I06+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
JMFS019A12+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF048B12+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
rJMFF012N13+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAANTTGCTTTTGAGTT
rJMFF045B06+ CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
                      ____________________________________________________________
consensus CCTGAACATAAGACCAACTATGTAAGAGAGGTGGAAGGCAGTATAAATTGCTTTTGAGTT
 
. : . : . : . : . : . :
rJMSF018B07+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF047F14+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF018N23+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF032K13+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF016F08+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF034C11+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF032E15+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF026F11+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF045N05+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF024K21+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF046A03+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF009G13+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF009E21+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF010N01+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF033D20+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF012G21+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF016G22+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF013J06+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF016N06+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF010J08+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF028F23+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF029M11+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF013N15+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF021C10+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF016M08+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF001C21+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF012C13+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF010G12+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF025O07+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF020E09+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF037B15+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF028B08+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF041D07+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF045J12+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF039P07+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF045N12+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTACGTGTAAATTTGATGTTTACC
rJMFF028F10+ GAAATACATGCACGTTGTACTAANCGNCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMSF006C20+ GANATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATCTGATGTTCACC
rJMFF007B14+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF051O14+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF043I06+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
JMFS019A12+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTCATGTTTACC
rJMFF048B12+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF012N13+ GAAATACATGCACGNTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
rJMFF045B06+ GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
                      ____________________________________________________________
consensus GAAATACATGCACGTTGTACTAAACGGCACCGTTTATTAC-TGTAAATTTGATGTTTACC
 
. : . : . : . : . : . :
rJMSF018B07+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF047F14+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF018N23+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF032K13+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF016F08+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF034C11+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF032E15+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF026F11+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF045N05+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF024K21+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF046A03+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF009G13+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF009E21+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF010N01+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF033D20+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF012G21+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF016G22+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF013J06+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF016N06+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF010J08+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF028F23+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF029M11+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF013N15+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF021C10+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF016M08+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF001C21+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF012C13+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF010G12+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF025O07+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF020E09+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF037B15+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF028B08+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF041D07+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF045J12+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCC
rJMFF039P07+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMSF045N12+ GATGTTGTATTNNGGATTTTACAAAATAACTATGTTGTCA-TNTATCTGGTCCTATAT
rJMFF028F10+ GATGTTGTATTTNGGATTTTACAAAAT-ACTATGTTGTTA-TATAT
rJMSF006C20+ GATGTTGTATTTTGGANTNTACAAAAT-ACTATGTTGTTACTATATCNGGTCCTATATGT
rJMFF007B14+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF051O14+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF043I06+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
JMFS019A12+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
rJMFF048B12+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTAA-TATATCTGGTCCTATATGT
rJMFF012N13+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGN
rJMFF045B06+ GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
                      ____________________________________________________________
consensus GATGTTGTATTTTGGATTTTACAAAAT-ACTATGTTGTTA-TATATCTGGTCCTATATGT
 
. : . : . : . : . : . :
rJMSF018B07+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGAC
rJMSF047F14+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGAC
rJMSF018N23+ GA-CGATGCAAGTAAA-CTGGTA-CGATATAA-G
rJMSF032K13+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGAC
rJMSF016F08+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGAC
rJMSF034C11+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGG
rJMSF032E15+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGG
rJMSF026F11+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGG
rJMSF045N05+ GA-CGATGCAAGTAAANCTGGTA-CGATGTAA-GTAGA
rJMSF024K21+ GA-CGATGCAAGTAAACCTGGTA-CGATGTAA-GTAGACTGG
rJMSF046A03+ GANCGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGG
rJMSF009G13+ GACCGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGG
rJMSF009E21+ GA-CGATGCAAGTAAA-CTGGTACCGATGTAA-GTAGACTGG
rJMSF010N01+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF033D20+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF012G21+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF016G22+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCNGA
rJMFF013J06+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAA
rJMFF016N06+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAAT
rJMFF010J08+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMSF028F23+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF029M11+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF013N15+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF021C10+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF016M08+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMSF001C21+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF012C13+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCNGA
rJMFF010G12+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF025O07+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF020E09+ GA-CGATGCAAGCAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGC
rJMFF037B15+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF028B08+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMSF041D07+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATG
rJMFF039P07+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMSF006C20+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAACGTAGACTGGGACAATGTTCTAGCCTGA
rJMFF007B14+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF051O14+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF043I06+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
JMFS019A12+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF048B12+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF012N13+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
rJMFF045B06+ GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
                      ____________________________________________________________
consensus GA-CGATGCAAGTAAA-CTGGTA-CGATGTAA-GTAGACTGGGACAATGTTCTAGCCTGA
 
. : . : . : . : . : . :
rJMSF010N01+ ATAAAT
rJMFF033D20+ ATAAA
rJMFF012G21+ ATAAA
rJMFF016G22+ ATAAA
rJMFF010J08+ ATAAATTATCGT
rJMSF028F23+ ATAAATTATCGTTATTGTG
rJMFF029M11+ ATAAATTATCGT
rJMFF013N15+ ATAAATTATCGTTATTG
rJMFF021C10+ ATAAAT
rJMFF016M08+ ATAAA
rJMSF001C21+ ATAA
rJMFF012C13+ ATAAAT
rJMFF010G12+ ATAAA
rJMFF025O07+ ATAAAT
rJMFF037B15+ ATAAAT
rJMFF028B08+ ATAAATTATCG
rJMFF039P07+ ATAAATTATCGTTAT
rJMSF006C20+ ATAAATTNTCGTTATT
rJMFF007B14+ ATAAATTATCGTTATTGTGTGG
rJMFF051O14+ ATAAATTATCGTTATTGTGTGG
rJMFF043I06+ ATAAATTATCGTTATTGTGTGGTCA
JMFS019A12+ ATAAATTATCGTTATTGTGTGGTCA
rJMFF048B12+ ATAAATAATCGTTATTGTGTGGTCA
rJMFF012N13+ ATANATTATCGTTATTGTGTGGTCAT
rJMFF045B06+ ATAAATTATCGTTATTGTGTGGTCATGTGTAATGCATTTTTGGTTATCTATCTTTGATAT
                      ____________________________________________________________
consensus ATAAATTATCGTTATTGTGTGGTCATGTGTAATGCATTTTTGGTTATCTATCTTTGATAT
 
. : . : . : . : . : . :
rJMFF045B06+ TTCAAATGATXXXXXXXXXXXXXXXXXXXXXXXTAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TTCAAATGATNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAAAAAAAAAACTCTCCAGGGT