Previous Contig 010491:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027L24Sequence501010491 (4)gb:AB020749_15146582e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY056224_1563718010491 (4)gb:AB020749_15146581e-66Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY056224_1563
JMFF045A18Sequence644010491 (4)gb:AB020749_15146582e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY056224_1563650010491 (4)gb:AB020749_15146588e-50Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY056224_1563

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045A18- GGTCATGGTTGGACAGTTGGACGATGCTCACACTTT
                      ____________________________________________________________
consensus GGTCATGGTTGGACAGTTGGACGATGCTCACACTTT
 
. : . : . : . : . : . :
JMFF045A18- ACTTTTGCGGGTTGATGTGCCCTTTCCCCTTTGTGAATTCTGATCGCCACTGTACTGCTG
                      ____________________________________________________________
consensus ACTTTTGCGGGTTGATGTGCCCTTTCCCCTTTGTGAATTCTGATCGCCACTGTACTGCTG
 
. : . : . : . : . : . :
JMFF027L24- GTGCTGTTGAATTCTTGATTTGGGAGAGAGAGATTGAGAGAGAGAAAGGGAAG
JMFF045A18- TAGTGCTGTGCTGTTGAATTCTTGATTTGGGAGAGAGAGATTGAGAGAGAGAAAGGGAAG
                      ____________________________________________________________
consensus TAGTGCTGTGCTGTTGAATTCTTGATTTGGGAGAGAGAGATTGAGAGAGAGAAAGGGAAG
 
. : . : . : . : . : . :
JMFF027L24- ATGGGTTTCAAAGAAGAGCAGCTGGACTACG-TTCTGGTGCCTGCGGGCATCGCAATTAT
JMFF045A18- ATGGGTTTCAAAGAAGAGCAGCTGGACTACGTTTCTGGTGCCTGCGGGCATCGCAATTAT
                      ____________________________________________________________
consensus ATGGGTTTCAAAGAAGAGCAGCTGGACTACGTTTCTGGTGCCTGCGGGCATCGCAATTAT
 
. : . : . : . : . : . :
JMFF027L24- GGTGTCGTACCATGCCTGGCTTCTCTTCACCATTGTCCGGAACCCCACCAGAACTGTGAT
JMFF045A18- GGTGTCGTACCATGCCTGGCTTCTCTTCACCATTGTCCGGAACCCCACCAGAACTGTGAT
rJMFF027L24+ GTGAT
                      ____________________________________________________________
consensus GGTGTCGTACCATGCCTGGCTTCTCTTCACCATTGTCCGGAACCCCACCAGAACTGTGAT
 
. : . : . : . : . : . :
JMFF027L24- CGGTATCAATGCCGAGTCTCGCCATAGCTGGGTCCACTCCATGATGTCCGATCCAATTAA
JMFF045A18- CGGTATCAATGCCGAGTCTCGCCATAGCTGGGTCCACTCCATGATGTCCGATCCAATTAA
rJMFF027L24+ CGGTATCAATGCCGAGTCTCGCCATAGCTGGGTCCACTCCATGATGTCCGATCCAATTAA
                      ____________________________________________________________
consensus CGGTATCAATGCCGAGTCTCGCCATAGCTGGGTCCACTCCATGATGTCCGATCCAATTAA
 
. : . : . : . : . : . :
JMFF027L24- GAACGGTGTTTTAACTGTTCAAACAATACGGAACAACATAATGGCTTCAACACTTTTGGC
JMFF045A18- GAACGGTGTTTTAACTGTTCAAACAATACGGAACAACATAATGGCTTCAACACTTTTGGC
rJMFF027L24+ GAACGGTGTTTTAACTGTTCAAACAATACGGAACAACATAATGGCTTCAACACTTTTGGC
                      ____________________________________________________________
consensus GAACGGTGTTTTAACTGTTCAAACAATACGGAACAACATAATGGCTTCAACACTTTTGGC
 
. : . : . : . : . : . :
JMFF027L24- AACCACAGCTATCACTCTCAGCTCGATAATAAGTGTATATGTGAGTGGCAAATCCGACCC
JMFF045A18- AACCACAGCTATCACTCTCAGCTCGATAATAAGTGTATATGTGAGTGGCAAATCCGACCC
rJMFF027L24+ AACCACAGCTATCACTCTCAGCTCGATAATAAGTGTATATGTGAGTGGCAAATCCGACCC
                      ____________________________________________________________
consensus AACCACAGCTATCACTCTCAGCTCGATAATAAGTGTATATGTGAGTGGCAAATCCGACCC
 
. : . : . : . : . : . :
JMFF027L24- TGCATCATCTAACCTTCTTTATGGCAACAAAACTGCAATTTTGTCTTCTGTAAAGTTCTT
JMFF045A18- TGCATCATCTAACCTTCTTTATGGCAACAAAACTGCAATTTTGTCTTCTGTAAAGTTCTT
rJMFF027L24+ TGCATCATCTAACCTTCTTTATGGCAACAAAACTGCAATTTTGTCTTCTGTAAAGTTCTT
rJMFF045A18+ AACCTTCTTTATGGCAACAAAACTGCAATTTTGTCTTCTGTAAAGTTCTT
                      ____________________________________________________________
consensus TGCATCATCTAACCTTCTTTATGGCAACAAAACTGCAATTTTGTCTTCTGTAAAGTTCTT
 
. : . : . : . : . : . :
JMFF027L24- CACCATCTTGCTATGCTTCCTCGTAGCTTTTCTCTGCAATGTGCAGTCTATTAGGTATTA
JMFF045A18- CACCATCTTGCTATGCTTCCTCGTAGCTTTTCTCTGCAATGTGCAGTCTATTAGGTATTA
rJMFF027L24+ CACCATCTTGCTATGCTTCCTCGTAGCTTTTCTCTGCAATGTGCAGTCTATTAGGTATTA
rJMFF045A18+ CACCATCTTGCTATGCTTCCTCGTAGCTNTTCTCTGCAATGTGCAGTCTATTAGGTATTA
                      ____________________________________________________________
consensus CACCATCTTGCTATGCTTCCTCGTAGCTTTTCTCTGCAATGTGCAGTCTATTAGGTATTA
 
. : . : . : . : . : . :
JMFF027L24- TGCCCATGTTAGCTTCTTAGCTACGGT
JMFF045A18- TGCCCATGTTAGCTTCTTAGCTACGGTGCCCACATTNCAAGATAGTACAGATTCTATAGA
rJMFF027L24+ TGCCCATGTTAGCTTCTTAGCTACGGTGCCCACATTCAAAGATAGTACAGATTCTATAGA
rJMFF045A18+ TGCCCATGTTAGCTTCTTAGCTACGGTGCCCACATTCAAAGATAGTACAGATTCTATAGA
                      ____________________________________________________________
consensus TGCCCATGTTAGCTTCTTAGCTACGGTGCCCACATTCAAAGATAGTACAGATTCTATAGA
 
. : . : . : . : . : . :
JMFF045A18- GTATGTTG
rJMFF027L24+ GTATGTTGTGAGAAATTTGAATCGAGGGAGCTACTTTTGGTCACTTGGGCTACGGGCGTT
rJMFF045A18+ GTATGTTGTGAGAAATTTGAATCGAGGGAGCTACTTTTGGTCACTTGGGCTACGGGCGTT
                      ____________________________________________________________
consensus GTATGTTGTGAGAAATTTGAATCGAGGGAGCTACTTTTGGTCACTTGGGCTACGGGCGTT
 
. : . : . : . : . : . :
rJMFF027L24+ TTACTTGTCATTCCCTCTCTTTCTTTGGGTTTTTGGGCCCATACCAATGTTTGTGTGTTG
rJMFF045A18+ TTACTTGTCATTCCCTCTCTTTCTTTGGGTTTTTGGGCCCATACCAATGTTTGTGTGTTG
                      ____________________________________________________________
consensus TTACTTGTCATTCCCTCTCTTTCTTTGGGTTTTTGGGCCCATACCAATGTTTGTGTGTTG
 
. : . : . : . : . : . :
rJMFF027L24+ TTGTGTACTGTCACTTGTTCTCTACTTCTTGGACACAACTACAAGCTTTACCAGGGATCT
rJMFF045A18+ TTGTGTACTGTCACTTGTTCTCTACTTCTTGGACACAACTACAAGCTTTACCAGGGATCT
                      ____________________________________________________________
consensus TTGTGTACTGTCACTTGTTCTCTACTTCTTGGACACAACTACAAGCTTTACCAGGGATCT
 
. : . : . : . : . : . :
rJMFF027L24+ CCATTCTCAATCTTTTAAACGGAAAGCAAATGATGCATAGTCATTCAATAGTTTGTTTGA
rJMFF045A18+ CCATTCTCAATCTTTTAAACGGAAAGCAAATGATGCATAGTCATTCAATAGTTTGTTTGA
                      ____________________________________________________________
consensus CCATTCTCAATCTTTTAAACGGAAAGCAAATGATGCATAGTCATTCAATAGTTTGTTTGA
 
. : . : . : . : . : . :
rJMFF027L24+ GGAGGTGATTATAGATTGTGCTAGAGGAGAAGGTGAACTATACGAGTATATCTCTGTTGA
rJMFF045A18+ GGAGGTGATTATAGATTGTGCTAGAGGAGAAGGTGAACTATACGAGTATATCTCTGTTGA
                      ____________________________________________________________
consensus GGAGGTGATTATAGATTGTGCTAGAGGAGAAGGTGAACTATACGAGTATATCTCTGTTGA
 
. : . : . : . : . : . :
rJMFF027L24+ TTGATCTGTACAATTATCCATCTCTGTTCCTCGCAATACCTCAA-GTAATACAA
rJMFF045A18+ TTGATCTGTACAATTATCCATCTCTGTTCCTCGCAATACCTCAATGTAATACAAAGTATG
                      ____________________________________________________________
consensus TTGATCTGTACAATTATCCATCTCTGTTCCTCGCAATACCTCAATGTAATACAAAGTATG
 
. : . : . : . : . : . :
rJMFF045A18+ TGTATGTATCTTCACACTCAGCTGTAGGAATCTACAGATTTAAACAGTGTAAGACAATAA
                      ____________________________________________________________
consensus TGTATGTATCTTCACACTCAGCTGTAGGAATCTACAGATTTAAACAGTGTAAGACAATAA
 
. : . : . : . : . : . :
rJMFF045A18+ ATAAACATAGTTATATCCGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ATAAACATAGTTATATCCGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG