Previous Contig 010488:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013C06Sequence563010488 (14)pir|T01726|T017263e-44hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar643010488 (14)pir|T01726|T017264e-44hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar
JMFF015K14Sequence620010488 (14)pir|T01726|T017266e-48hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar664010488 (14)pir|T01726|T017261e-46hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar
JMFF045A02Sequence635010488 (14)pir|T01726|T017267e-48hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar629010488 (14)pir|T01726|T017263e-44hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar
JMSF004N09Sequence338011299 (10)gb:AP003513_18301935e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P069151010488 (14)
JMSF004P11Sequence249010488 (14)
JMSF007J16Sequence338010488 (14)pir|T01726|T017264e-19hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar729010488 (14)pir|T01726|T017269e-48hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar
JMSF008J16Sequence361005013 (3)728010488 (14)pir|T01726|T017267e-48hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar
JMSF015G13Sequence516010488 (14)pir|T01726|T017262e-42hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar682010488 (14)pir|T01726|T017268e-48hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar
JMSF030E01Sequence626011178 (3)gb:AC139168_17439857e-69Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1364E02, complete s743010488 (14)pir|T01726|T017269e-48hypothetical protein A_IG002N01.18 - Arabidopsis thaliana>gb:ATCHRIV3_1544801 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF004P11- AAAGCTATACCAACAGCCACACCCAAAGAGAACAGTAGTGGCCTGATG
JMFF045A02- ACCCAAAGAGAACAGTAGTGGCCTGATG
JMFF015K14- ACCCAAAGAGAACAGTAGTGGCCTGATG
JMSF007J16- AGTAGTGGCCTGATG
rJMSF030E01+ CACACCCAAAGAGACCAGTAGTGGCCTGATG
rJMSF008J16+ AGTAGTGGCCTGATG
rJMSF007J16+ AGTAGTGGCCTGATG
                      ____________________________________________________________
consensus AAAGCTATACCAACAGCCACACCCAAAGAGAACAGTAGTGGCCTGATG
 
. : . : . : . : . : . :
JMSF004P11- ATGGCAAGCGCAGCTTCCACTTCCATGGCGGCGACAGCCGTCTTCAG-CCCAAGATTCGC
JMFF045A02- ATGGCAAGCGCAGCTTCCACTTCCATGGCGGCGACAGCCGTCTTCAG-CCCAAGATTCGC
JMFF015K14- ATGGCAAGCGCAGCTTCCACTTCCATGGCGGCGACAGCCGTCTTCAG-CCCAAGATTCGC
JMSF007J16- ATGGCAAGCGCAGCTTCCACTTCCATGGCGGCGACAGCCGTCTTCAG-CCCAAGATTCGC
rJMSF030E01+ ATGGCAAGCGCAGCTTCCACTTCCATGGCGGCGACAGCCGTCTTCAG-CCCAAGATTCGC
rJMSF008J16+ ATGGCAAGCGCAGCTTCCACTTCCATGGCGGCGACAGCCGTCTTCAGCCCCAAGATTCGC
rJMFF015K14+ CCAAGATTCGC
rJMSF007J16+ ATGGCAAGCGCAGCTTCCACTTCCATGGCGGCGACAGCCGTCTTCAG-CCCAAGATTCGC
                      ____________________________________________________________
consensus ATGGCAAGCGCAGCTTCCACTTCCATGGCGGCGACAGCCGTCTTCAG-CCCAAGATTCGC
 
. : . : . : . : . : . :
JMSF004P11- CGTCTACTCCACCCCCAACCGCAGCTGTGCGTTGCCGTACCCACCGCTACCCAGAGTTTC
JMFF045A02- CGTCTACTCCACCCCCAACCGCAGCTGTGCGTTGCCGTACCCACCGCTACCCAGAGTTTC
JMFF015K14- CGTCTACTCCACCCCCAACCGCAGCTGTGCGTTGCCGTACCCACCGCTACCCAGAGTTTC
JMSF007J16- CGTCTACTCCACCCCCAACCGCAGCTGTGCGTTGCCGTACCCACCGCTACCCAGAGTTTC
rJMSF030E01+ CGTCTACTCCACCCCCAACCGCAGCTGTGCGTTGCCGTACCCACCGCTACCCAGAGTTTC
rJMSF008J16+ CGTCTACTCCACCCCCAACCGCAGCTGTGCGTTGCCGTACCCACCGCTACCCAGAGTTTC
rJMFF015K14+ CGTNTACTCCACCCCCAACCGCAGCTGTGCGTTGCNGTACCCACCGCTACCCAGAGTTTC
rJMSF007J16+ CGTCTACTCCACCCCCAACCGCAGCTGTGCGTTGCCGTACCCACCGCTACCCAGAGTTTC
                      ____________________________________________________________
consensus CGTCTACTCCACCCCCAACCGCAGCTGTGCGTTGCCGTACCCACCGCTACCCAGAGTTTC
 
. : . : . : . : . : . :
JMSF004P11- CGTTCCTGCTTTCTCTGCCCCCCTCAAACTAAAGG
JMFF045A02- CGTTCCTGCTTTCTCTGCCCCCCTCAAACTAAAGGAACCCAAGAGGTCTTCTCTTCTGCA
JMFF015K14- CGTTCCTGCTTTCTCTGCCCCCCTCAAACTAAAGGAACCCAAGAGGTCTTCTCTTCTGCA
JMSF007J16- CGTTCCTGCTTTCTCTGCCCCCCTCAAACTAAAGGAACCCAAGAGGTCTTCTCTTCTGCA
rJMSF030E01+ CGTTCCTGCTTTCTCTGCCCCCCTCAAACTAAAGGAACCCAAGAGGTCTTCTCTTCTGCA
rJMSF008J16+ CGNTCNTGCTTTCTCTGCCCCCCTCAAACTAAAGGAACCCAAGAGGTCTTCTCTTCTGCA
JMFF013C06- AACCCAAGAGGTCTTCTCTTCTGCA
rJMFF013C06+ AACCCAAGAGGTCTTCTCTTCTGCA
rJMSF015G13+ GAACCCAAGAGGTCTTCTCTTCTGCA
rJMFF015K14+ CGTTCCTGCTTTCTCTGCCCCCCTCAAACTAAAGGAACCCAAGAGGTCTTCTCTTCTGCA
JMSF015G13- GAACCCAAGAGGTCTTCTCTTCTGCA
rJMSF007J16+ CGTTCCTGCTTTCTCTGCCCCCCTCAAACTAAAGGAACCCAAGAGGTCTTCTCTTCTGCA
rJMFF045A02+ AAAGGAACCCAAGAGGTCTTCTCTTCTGCA
                      ____________________________________________________________
consensus CGTTCCTGCTTTCTCTGCCCCCCTCAAACTAAAGGAACCCAAGAGGTCTTCTCTTCTGCA
 
. : . : . : . : . : . :
JMFF045A02- GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
JMFF015K14- GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
JMSF007J16- GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
rJMSF030E01+ GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
rJMSF008J16+ GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
JMFF013C06- GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
rJMFF013C06+ GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
rJMSF015G13+ GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
rJMFF015K14+ GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
JMSF015G13- GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
rJMSF007J16+ GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
rJMFF045A02+ GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
                      ____________________________________________________________
consensus GGTCAAAGCATCTTCATCTGAGGATACATCTCTTGATGCTAATGAGTTGTTTACTGATCT
 
. : . : . : . : . : . :
JMFF045A02- AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
JMFF015K14- AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
JMSF007J16- AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
rJMSF030E01+ AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
rJMSF008J16+ AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
JMFF013C06- AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
rJMFF013C06+ AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
rJMSF015G13+ AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
rJMFF015K14+ AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
JMSF015G13- AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
rJMSF007J16+ AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
rJMFF045A02+ AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
                      ____________________________________________________________
consensus AAAAGAAAAGTGGGATGCCCTTGAAAACAAGTCTACCGTACTTCTTTATGGAGGTGGGGC
 
. : . : . : . : . : . :
JMFF045A02- AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
JMFF015K14- AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
JMSF007J16- AATCGTTGCAGTTTGGCTCGCTT
rJMSF030E01+ AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
rJMSF008J16+ AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
JMFF013C06- AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
rJMFF013C06+ AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
rJMSF015G13+ AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
rJMFF015K14+ AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
JMSF015G13- AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
rJMSF007J16+ AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
rJMFF045A02+ AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
                      ____________________________________________________________
consensus AATCGTTGCAGTTTGGCTCGCTTCAACACTTGTGGGTGCCATCAACTCAGTTCCTCTGCT
 
. : . : . : . : . : . :
JMFF045A02- TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
JMFF015K14- TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
rJMSF030E01+ TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
rJMSF008J16+ TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
JMFF013C06- TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
rJMFF013C06+ TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
rJMSF015G13+ TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
rJMFF015K14+ TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
JMSF015G13- TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
rJMSF007J16+ TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
rJMFF045A02+ TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
                      ____________________________________________________________
consensus TCCCAAAATCATGGAGCTGGTGGGGCTCGGATATACTGGATGGTTTGTCTATCGTTACCT
 
. : . : . : . : . : . :
JMFF045A02- TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
JMFF015K14- TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
rJMSF030E01+ TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
rJMSF008J16+ TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
JMFF013C06- TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
rJMFF013C06+ TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
rJMSF015G13+ TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
rJMFF015K14+ TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
JMSF015G13- TCTCTTCAAGTCACGCAGGAAAGAACTGGCAG
rJMSF007J16+ TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
rJMFF045A02+ TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
                      ____________________________________________________________
consensus TCTCTTCAAGTCACGCAGGAAAGAACTGGCAGAAGACATTGAAGTGTTGAAGAAGAAGAT
 
. : . : . : . : . : . :
JMFF045A02- CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
JMFF015K14- CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
rJMSF030E01+ CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
rJMSF008J16+ CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
JMFF013C06- CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
rJMFF013C06+ CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
rJMSF015G13+ CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
rJMFF015K14+ CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
rJMSF007J16+ CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
rJMFF045A02+ CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
                      ____________________________________________________________
consensus CTCGGGAGGATTTGAGTAGATGCAAAGGTGAACCCCAACATCATTTCATATTGATCCGTG
 
. : . : . : . : . : . :
JMFF045A02- CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
JMFF015K14- CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATT
rJMSF030E01+ CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
rJMSF008J16+ CTACATTTTCATCGCGTATAGTATTATNAGAGGCAAAATCTCTAATAACAATTGAAGGCT
JMFF013C06- CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
rJMFF013C06+ CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
rJMSF015G13+ CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
rJMSF004N09+ GCGTATAGTATTATNAGAGGCAAAATCTNCAATAACANTTGAAGGCT
rJMFF015K14+ CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
rJMSF007J16+ CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
rJMFF045A02+ CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
                      ____________________________________________________________
consensus CTACATTTTCATCGCGTATAGTATTATTAGAGGCAAAATCTCTAATAACAATTGAAGGCT
 
. : . : . : . : . : . :
JMFF045A02- TCCTATGT
rJMSF030E01+ TCCTATGTAGGAGTACTTGTGTTTTGTNTAAGGTTTTTCTTGCAATGAGATTCTGTATT-
rJMSF008J16+ TCCTATGTAGGAGTACTTGTGTTTTGTTTAAGGTTTTTCTNGCAATGAGATTCTGTATT-
JMFF013C06- TCCTATGTAGGAGTACTTGTGTTT
rJMFF013C06+ TCCTATGTAGGAGTACTTGTGTTTTGTTTAAGGTTTTTCTTGCAATGAGATTCTGTATT-
rJMSF015G13+ TCCTATGTAGGAGTACTT
rJMSF004N09+ TCCTATGTAGGAGTACTTGTGTGTCGTTCAAGGTTTNTCTCGCACTNAGATTCTGTATTC
rJMFF015K14+ TCCTATGTAGGAGTACTTGTGTTTTGTTTAAGGTTTTTCTTGCAATGAGATTCTGTATT-
rJMSF007J16+ TCCTATGTAGGAGTACTTGTGTTTTGTTTAAGGTTTTTCTTGCAATGAGATTCTGTATT-
rJMFF045A02+ TCCTATGTAGGAGTACTTGTGTTTTGTTTAAGGTTTTTCTTGCAATGAGATTCTGTATT-
                      ____________________________________________________________
consensus TCCTATGTAGGAGTACTTGTGTTTTGTTTAAGGTTTTTCTTGCAATGAGATTCTGTATT-
 
. : . : . : . : . : . :
rJMSF030E01+ CAACTTGATCTGTGTTTAAGAATCTTTCTGTAAATACTGCATTGTCTGTACTAT
rJMSF008J16+ CAACTTGATCTGTGTTTAAGAATCTTTCTGTAAATACTGC
rJMFF013C06+ CAACTTGATC
rJMSF004N09+ CCACNTGATCTGNGTCTAAGAATCTTTCTGTAAATACTGCATTG
rJMFF015K14+ CAACTTGATCTGTGTTTAAGAATCTTTCTGTAAATACTGCATTGTCTGTACTAT
rJMSF007J16+ CAACTTGATCTGTGTTTAAGAATCTTTCTGTAAATACTGCATTGTCTGTACTAT
rJMFF045A02+ CAACTTGATCTGTGTTTAAGAATCTTTCTGTAAATACTGCATTGTCTGTACTATGTAGTT
                      ____________________________________________________________
consensus CAACTTGATCTGTGTTTAAGAATCTTTCTGTAAATACTGCATTGTCTGTACTATGTAGTT
 
. : . : . : . : . : . :
rJMFF045A02+ TTGGATGACTAAAAAGCATATAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTGGATGACTAAAAAGCATATAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG