Previous Contig 010485:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011K09Sequence704010485 (13)gb:AX250465_14648307e-07Sequence 71 from Patent WO0168863.
JMFF015B09Sequence577010485 (13)gb:AX250465_14648302e-14Sequence 71 from Patent WO0168863.
JMFF028K12Sequence696010485 (13)gb:AX250465_14648307e-07Sequence 71 from Patent WO0168863.
JMFF028M15Sequence668010485 (13)gb:AX250465_14648306e-07Sequence 71 from Patent WO0168863.
JMFF037O15Sequence675010485 (13)gb:AX250465_14648306e-08Sequence 71 from Patent WO0168863.
JMFF044P20Sequence518010485 (13)646010485 (13)
JMFF051L11Sequence577010485 (13)591010485 (13)gb:AX250465_14648302e-14Sequence 71 from Patent WO0168863.
JMFS121F10Sequence483010485 (13)
JMSF005G06Sequence452010485 (13)
JMSF034E19Sequence664010485 (13)gb:AX250465_14648305e-11Sequence 71 from Patent WO0168863.
JMSF037A07Sequence279010485 (13)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF051L11- GACACGAAATCAAAGCTGGGCGGCCATCTCTCTATATTTCTCTGTCTATATCTCTC
                      ____________________________________________________________
consensus GACACGAAATCAAAGCTGGGCGGCCATCTCTCTATATTTCTCTGTCTATATCTCTC
 
. : . : . : . : . : . :
JMFF051L11- TCTCTCTCACGCGTCGTTCATTGCGAAACCACCCACCCCTTTCCTCCTCATCTTTTCTTC
JMFS121F10- TCCTCATCTTTTCTTC
                      ____________________________________________________________
consensus TCTCTCTCACGCGTCGTTCATTGCGAAACCACCCACCCCTTTCCTCCTCATCTTTTCTTC
 
. : . : . : . : . : . :
JMFF051L11- GTCCTCGTATATAAACCTACCATTCTGGATCCTCCATTTCTGTGAACTGGAATTTCCAGT
JMFS121F10- GTCCTCGTATATAAACCTACCATTCTGGATCCTCCATTTCTGTGAACTGGAATTTCCAGT
JMFF044P20- GTGAACTGGAATTTCCAGT
                      ____________________________________________________________
consensus GTCCTCGTATATAAACCTACCATTCTGGATCCTCCATTTCTGTGAACTGGAATTTCCAGT
 
. : . : . : . : . : . :
JMFF051L11- ATAAAAACCTCAAAAAAAAACAAAAAAAAAAATTATTTTCTGAAACAGAGCGGGAAGGAA
JMFS121F10- ATAAAAACCTCAAAAAAAAAC-AAAAAAAAAATTATTTTCTGAAACAGAGCGGGAAGGAA
JMFF044P20- ATAAAAACCTCAAAAAAAAACAAAAAAAAAAATTATTTTCTGAAACAGAGCGGGAAGGAA
                      ____________________________________________________________
consensus ATAAAAACCTCAAAAAAAAACAAAAAAAAAAATTATTTTCTGAAACAGAGCGGGAAGGAA
 
. : . : . : . : . : . :
JMFF051L11- AAGTATTTTTCAGCGACTCATTTCCTCCTTTGCTCTGTAAACCC---XXXXXXXXXXXXX
JMFS121F10- AAGTATTTTTCAGCGACTCATTTCCTCCTTTGCTCTGTAAACCCXXXXXXXXXXXXXXXX
JMFF044P20- AAGTATTTTTCAGCGACTCATTTCCTCCTTTGCTCTGTAAACCCX--XXXXXXXXXXXXX
                      ____________________________________________________________
consensus AAGTATTTTTCAGCGACTCATTTCCTCCTTTGCTCTGTAAACCCN--NNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFF051L11- XXXXXXXCCTCTCTTGCTTTTCTCCTCACACACAGATCTTCCATTAATCTCCGGCGGATT
JMFS121F10- XXXXXXXCCTCTCTTGCTTTTCTCCTCACACACAGATCTTCCATTAATCTCCGGCGGATT
JMFF044P20- XXXXXXXCCTCTCTTGCTTTTCTCCTCACACACAGATCTTCCATTAATCTCCGGCGGATT
                      ____________________________________________________________
consensus NNNNNNNCCTCTCTTGCTTTTCTCCTCACACACAGATCTTCCATTAATCTCCGGCGGATT
 
. : . : . : . : . : . :
JMFF051L11- CTGTTTTTTACCTTCCTTTTTTTTTTTTTGTCTGGGTAGGCGTTGTTCAGCTGCTAATCT
JMFS121F10- CTGTTTTTTACCTTCCTTTTTTTTTTTTTGTCTGGGTAGGCGTTGTTCAGCTGCTAATCT
JMFF044P20- CTGTTTTTTACCTTCC-TTTTTTTTTTTTGTCTGGGTAGGCGTTGTTCAGCTGCTAATCT
                      ____________________________________________________________
consensus CTGTTTTTTACCTTCCTTTTTTTTTTTTTGTCTGGGTAGGCGTTGTTCAGCTGCTAATCT
 
. : . : . : . : . : . :
JMFF051L11- TTAGATGTTTGTGGAGTTTATTGTTTGAATTATTTGTTTTTTTCGGAAGGGAAAAAATGG
JMFS121F10- TTAAATGTTTGGGGAGTTTATTGTTTGAATTATTTGTTTTTTTCGGAAGGGAAAAAATGG
JMFF044P20- TTAAATGTTTGTGGAGTTTATTGTTTGAATTATTTGTTTTTTTCGGAAGGGAAAAAATGG
                      ____________________________________________________________
consensus TTAAATGTTTGTGGAGTTTATTGTTTGAATTATTTGTTTTTTTCGGAAGGGAAAAAATGG
 
. : . : . : . : . : . :
JMFF051L11- GAACGGAGGTTCTTAGACCGCAGGATTGTTTGGGTGAGAGGGTGAACCCGTTTCATCGCC
JMFS121F10- GAACGGAGGTTCTTAAACCGCAGGATTGTTTGGGTGAAAGGGTGAACCCGTTTCATCGCC
JMFF044P20- GAACGGAGGTTCTTAAACCGCAGGATTGTTTGGGTGAGAGGGTGAACCCGTTTCATCGCC
rJMFF051L11+ GCC
                      ____________________________________________________________
consensus GAACGGAGGTTCTTAAACCGCAGGATTGTTTGGGTGAGAGGGTGAACCCGTTTCATCGCC
 
. : . : . : . : . : . :
JMFF051L11- GGAAAA
JMFS121F10- GTAAAA
JMFF044P20- GGAAAAATGGGTACGCCGTCGGGGGGAGCGGGGCGTTTTACCCCCGTAATAGGAAACAGG
rJMFF051L11+ GGAAAAATGGGTACGCCGTCGGGGGGAGCGGGGCGTTTTACCCCCGTAATAGGAAACAGG
                      ____________________________________________________________
consensus GGAAAAATGGGTACGCCGTCGGGGGGAGCGGGGCGTTTTACCCCCGTAATAGGAAACAGG
 
. : . : . : . : . : . :
JMFF044P20- TGGTTAGGTCGGAGAAGAAGAGATACAACGCGGCGGCGGCGGAGGCCGTACCGGCGAGTC
rJMFF051L11+ TGGTTAGGTCGGAGAAGAAGAGATACAACGCGGCGGCGGCGGAGGCCGTACCGGCGAGTC
rJMFF015B09+ C
                      ____________________________________________________________
consensus TGGTTAGGTCGGAGAAGAAGAGATACAACGCGGCGGCGGCGGAGGCCGTACCGGCGAGTC
 
. : . : . : . : . : . :
JMFF044P20- CCAGACGAACGCCCAGCGCTG
rJMFF051L11+ CCAGACGAACGCCCAGCGCTGAGAATTTGAGACACGGCGGCGGCCAGAGCTGGAAGCCCG
rJMFF015B09+ CCAGACGAACGCCCAGCGNTGAGAATTTGAGACACGGCGGCGGCCAGAGCTGGAAGCCCG
                      ____________________________________________________________
consensus CCAGACGAACGCCCAGCGCTGAGAATTTGAGACACGGCGGCGGCCAGAGCTGGAAGCCCG
 
. : . : . : . : . : . :
rJMFF051L11+ CCGAGCTCGTGATGGGGCGGGTGACGATCTTGCGGCGGGGGGATTCGATGGACTCCCTCA
rJMFF015B09+ CCGAGCTCGTGATGGGGCGGGTGACGATCTTGCGGCGGGGGGATTCGATGGACTCCCTCA
rJMSF034E19+ CTTGCGGCGGGGGGATTCGATGGACTCCCTCA
                      ____________________________________________________________
consensus CCGAGCTCGTGATGGGGCGGGTGACGATCTTGCGGCGGGGGGATTCGATGGACTCCCTCA
 
. : . : . : . : . : . :
rJMFF051L11+ ACTCGAAGACCCACCGCGACAACAAGGCCGCGCCGGCGCCGCCGAAGAGCGGCGGCGGCG
rJMFF015B09+ ACTCGAAGACCCACCGCGACAACAAGGCCGCGCCGGCGCCGCCGAAGAGCGGCGGCGGCG
rJMSF034E19+ ACTCGAAGACCCACCGCGACAACAAGGCCGCGCCGGCGCCGCCGAAGAGCGGCGGCGGCG
rJMFF028M15+ GCCGCGCCGGCGCCGCCGAAGAGCGGCGGCGGCG
rJMFF028K12+ GCCGCGCCGGCGCCGCCGAAGAGCGGCGGCGGCG
rJMFF037O15+ GGCGGCGGCG
rJMFF011K09+ GCGCCGGCGCCGCCGAAGAGCGGCGGCGGCG
                      ____________________________________________________________
consensus ACTCGAAGACCCACCGCGACAACAAGGCCGCGCCGGCGCCGCCGAAGAGCGGCGGCGGCG
 
. : . : . : . : . : . :
rJMFF051L11+ ACGGTGAC-GGTGACGATTTGGTGGTGTTCGGGACCAGCAGACTGGGCCCGGAGCAGCCC
rJMFF015B09+ ACGGTGAC-GGTGACGATTTGGTGGTGTTCGGGACCAGCAGACTGGGCCCGGAGCAGCCC
rJMSF034E19+ ACGGTGAC-GGTGACGATTNGGTGGTGTTCGGGACCAGCAGACTGGGCCCGGAGCAGCCC
rJMFF028M15+ ACGGTGAC-GGTGACGATTTGGTGGTGTTCGGGACCAGCAGACTGGGCCCGGAGCAGCCC
rJMFF028K12+ ACGGTGAC-GGTGACGATTTGGTGGTGTTCGGGACCAGCAGACTGGGCCCGGAGCAGCCC
rJMFF037O15+ ACGGTGACGGGTGACGATTTGGTGGTGTTCGGGACCAGCAGACTGGGCCCGGAGCAGCCC
rJMFF011K09+ ACGGTGAC-GGTGACGATTTGGTGGTGTTCGGGACCAGCAGACTGGGCCCGGAGCAGCCC
                      ____________________________________________________________
consensus ACGGTGAC-GGTGACGATTTGGTGGTGTTCGGGACCAGCAGACTGGGCCCGGAGCAGCCC
 
. : . : . : . : . : . :
rJMFF051L11+ GTCATGATTCCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
rJMFF015B09+ GTCATGATTCCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
rJMSF034E19+ GTCATGATTCCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
rJMFF028M15+ GTCATGATTCCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
rJMFF028K12+ GTCATGATTCCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
rJMFF037O15+ GTCATGATTCCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
rJMFF011K09+ GTCATGATTCCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
rJMFF044P20+ CCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
                      ____________________________________________________________
consensus GTCATGATTCCCAAGCAGATACGCGTCAGCCGCTTGTCCGGCGACGTTTACGCCGGCTCC
 
. : . : . : . : . : . :
rJMFF051L11+ GGCTTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
rJMFF015B09+ GGCTTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
rJMSF034E19+ GGCTTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
rJMFF028M15+ GGCTTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
rJMFF028K12+ GGCTTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
rJMFF037O15+ GGCTTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
rJMSF037A07+ GATCTCTGCCTTTGCCTTCATTCTTCAACAACGNC
rJMFF011K09+ GGCTTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
rJMFF044P20+ GG-TTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
                      ____________________________________________________________
consensus GGCTTCTCCAACTCGCCGTCGCCGAGATCTCTGCCTTTGCCTTCATTCTTCAACAACG-C
 
. : . : . : . : . : . :
rJMFF051L11+ TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTCGGCAACCCGAGACT
rJMFF015B09+ TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTCGGCAACCCGAGACT
rJMSF034E19+ TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTNGGCAACCCGAGACT
rJMFF028M15+ TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTCGGCAACCCGAGACT
rJMFF028K12+ TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTCGGCAACCCGAGACT
rJMFF037O15+ TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTCGGCAACCCGAGACT
rJMSF005G06+ AAGAAGCAAGACGGGTCGAACA-CGACGTCGTNTGACGACTCGGCANCCCGAGACT
rJMSF037A07+ TAACAAGAAGCAAGACGGGTCGAACAGTGACGTCGTTTGACGACTCGNCAACCNGANNCT
rJMFF011K09+ TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTCGGCAACCCGAGACT
rJMFF044P20+ TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTCGGCAACCCGAGACT
                      ____________________________________________________________
consensus TAACAAGAAGCAAGACGGGTCGAACA-CGACGTCGTTTGACGACTCGGCAACCCGAGACT
 
. : . : . : . : . : . :
rJMFF051L11+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCC
rJMFF015B09+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
rJMSF034E19+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
rJMFF028M15+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
rJMFF028K12+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
rJMFF037O15+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
rJMSF005G06+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
rJMSF037A07+ TGAGNCGGTTGCTCCGNCTCGANTAGGAAAATCNGGTCCGGATCCGGGTCGGTGCCCTCG
rJMFF011K09+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
rJMFF044P20+ TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
                      ____________________________________________________________
consensus TGAGACGGTTGCTCCGACTCGAATAGGAAAATCGGGTCCGGATCCGGGTCGGTGCCCTCG
 
. : . : . : . : . : . :
rJMFF015B09+ ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTTTTTTGCACATATGGAGTGA
rJMSF034E19+ ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTTTTTTGCACATATGGAGTGA
rJMFF028M15+ ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTTTTTTGCACATATGGAGTGA
rJMFF028K12+ ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTTTTTTGCACATATGGAGTGA
rJMFF037O15+ ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTTTTTTGCACATATGGAGTGA
rJMSF005G06+ ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTNTTTTGCACATATGGAGTGA
rJMSF037A07+ ATGTTTTCAAGNTCCATATAAATNCCTCCAATNGATTGGTTTNNTGCACATATGGAGTGA
rJMFF011K09+ ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTTTTTTGCACATATGGAGTGA
rJMFF044P20+ ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTTTTTTGCACATATGGAGTGA
                      ____________________________________________________________
consensus ATGTTTTCAAGATCCATATAAATCCCTCCAATAGATTGGTTTTTTGCACATATGGAGTGA
 
. : . : . : . : . : . :
rJMFF015B09+ TTAAAGTGGGTCTGAAAATTGAGGGAATAAATAAATTAA
rJMSF034E19+ TTAAAGNGGGTCTGAAAATTGAGGGAATAAATAAATTAAAACACCGATTAAAACTTAAAA
rJMFF028M15+ TTAAAGTGGGTCTGAAAATTGAGGGAATAAATAAATTAAAACACCGATTAAAACTTAAAA
rJMFF028K12+ TTAAAGTGGGTCTGAAAATTGAGGGAATAAATAAATTAAAACACCGATTAAAACTTAAAA
rJMFF037O15+ TTAAAGTGGGTCTGAAAATTGAGGGAATAAATAAATTAAAACACCGATTAAAACTTAAAA
rJMSF005G06+ TTAAAGTGGGTCTGAAANTTGAGGGAATAAATAAANTAAAACACCGATTAAAACTTAAAA
rJMSF037A07+ TTAAAGTGGGTCTGAAAATTGAGGGAATAAATAAACTAAAACACCGATTAA
rJMFF011K09+ TTAAAGTGGGTCTGAAAATTGAGGGAATAAATAAATTAAAACACCGATTAAAACTTAAAA
rJMFF044P20+ TTAAAGTGGGTCTGAAAATTGAGGGAATAAATAAATTAAAACACCGATTAAAACTTAAAA
                      ____________________________________________________________
consensus TTAAAGTGGGTCTGAAAATTGAGGGAATAAATAAATTAAAACACCGATTAAAACTTAAAA
 
. : . : . : . : . : . :
rJMSF034E19+ AGGATCCTATTTTTCTACTAATTATTAATAATCGTTATAATATATATTANCTAAGTTGGG
rJMFF028M15+ AGGATCCTATTTTTCTACTAATTATTAATAATCGTTATAATATATATTAATTAAGTTGGG
rJMFF028K12+ AGGATCCTATTTTTCTACTAATTATTAATAATCGTTATAATATATATTAATTAAGTTGGG
rJMFF037O15+ AGGATCCTATTTTTCTACTAATTATTAATAATCGTTATAATATATATTAATTAAGTTGGG
rJMSF005G06+ AGGATCCTATTTTTCTACTAATTATTNATAATCGTTATAATATATATTAATTAAGTTGGG
rJMFF011K09+ AGGATCCTATTTTTCTACTAATTATTAATAATCGTTATAATATATATTAATTAAGTTGGG
rJMFF044P20+ AGGATCCTATTTTTCTACTAATTATTAATAATCGTTATAATATATATTAATTAAGTTGGG
                      ____________________________________________________________
consensus AGGATCCTATTTTTCTACTAATTATTAATAATCGTTATAATATATATTAATTAAGTTGGG
 
. : . : . : . : . : . :
rJMSF034E19+ TTAATNTGAAGGGTATTGTTGTAATTTCACGTGTANGAGTGAGGAGAGAAGAGTACTTGT
rJMFF028M15+ TTAATTTGAAGGGTATTGTTGTAATTTCACGTGTAAGAGTGAGGAGAGAAGAGTACTTGT
rJMFF028K12+ TTAATTTGAAGGGTATTGTTGTAATTTCACGTGTAAGAGTGAGGAGAGAAGAGTACTTGT
rJMFF037O15+ TTAATTTGAAGGGTATTGTTGTAATTTCACGTGTAAGAGTGAGGAGAGAAGAGTACTTGT
rJMSF005G06+ TTAATTTGAAGGGTATTGTNGTAATTTCACGTGTAAGAGTGAGGAGAGAAGAGTACTTGT
rJMFF011K09+ TTAATTTGAAGGGTATTGTTGTAATTTCACGTGTAAGAGTGAGGAGAGAAGAGTACTTGT
rJMFF044P20+ TTAATTTGAAGGGTATTGTTGTAATTTCACGTGTAAGAGTGAGGAGAGAAGAGTACTTGT
                      ____________________________________________________________
consensus TTAATTTGAAGGGTATTGTTGTAATTTCACGTGTAAGAGTGAGGAGAGAAGAGTACTTGT
 
. : . : . : . : . : . :
rJMSF034E19+ CATAATGTTA-TTAC
rJMFF028M15+ CATAATGTTA-TTACTACTAAGTACCAATTCAAATGTATAATGGTCTGTTTATATTTGGT
rJMFF028K12+ CATAATGTTA-TTACTACTAAGTACCAATTCAAATGTATAATGGTCTGTTTATATTTGGT
rJMFF037O15+ CATAATGTTA-TTACTACTAAGTACCAATTCAAATGTATAATGGTCTGTTTATATTTGGT
rJMSF005G06+ CATAATGTTAGTTACTACTAAGTACCAATTCAAATGTATAATGGTCTGTTTATATTTGGT
rJMFF011K09+ CATAATGTTA-TTACTACTAAGTACCAATTCAAATGTATAATGGTCTGTTTATATTTGGT
rJMFF044P20+ CATAATGTTA-TTACTACTAAGTACCAATTCAAATGTATAATGGTCTGTTTATATTTGGT
                      ____________________________________________________________
consensus CATAATGTTA-TTACTACTAAGTACCAATTCAAATGTATAATGGTCTGTTTATATTTGGT
 
. : . : . : . : . : . :
rJMFF028M15+ GATGTAGAGGAAGAGGAGTTTTGTGAGCTCCAAATCTT
rJMFF028K12+ GATGTAGAGGAAGAGGAGTTTTGTGAGCTCCAAATCTTTGTAT-AATATCCCATTATTAT
rJMFF037O15+ GATGTAGAGGAAGAGGAGTTTTGTGAGCTCCAAATCTTTGTAT-AATATCCCANTATTAT
rJMSF005G06+ GATGTAGAGGAAGAGGAGTTNNGTNAGCTCCAAATCT
rJMFF011K09+ GATGTAGAGGAAGAGGAGTTTTGTGAGCTCCAAATCTTNGTATNAATATCCCATTATTA-
rJMFF044P20+ GATGTAGAGGAAGAGGAGTTTTGTGAGCTCCAAATCTTTGTAT-AATATCCCATTATTAT
                      ____________________________________________________________
consensus GATGTAGAGGAAGAGGAGTTTTGTGAGCTCCAAATCTTTGTAT-AATATCCCATTATTAT
 
. : . : . : . : . : . :
rJMFF011K09+ TGAATAATAGACAAAGA
rJMFF044P20+ TGAATAATAGACAAAGATGAACTATTTAGGAATAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGAATAATAGACAAAGATGAACTATTTAGGAATAAAAAAAAAAAAAAAACTCTCCAGGGT