Previous Contig 010484:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004C10Sequence562010484 (8)gb:AY084973_15700553e-28Arabidopsis thaliana clone 123128 mRNA, complete sequence.770010484 (8)gb:AY367058_16029187e-77Pisum sativum cultivar Alaska SAT5 mRNA, complete cds.
JMFF014D20Sequence575010484 (8)gb:AY084973_15700551e-33Arabidopsis thaliana clone 123128 mRNA, complete sequence.698010484 (8)gb:AY367058_16029184e-79Pisum sativum cultivar Alaska SAT5 mRNA, complete cds.
JMFF044P19Sequence598010484 (8)gb:AY084973_15700558e-58Arabidopsis thaliana clone 123128 mRNA, complete sequence.605010484 (8)gb:AY367058_16029182e-60Pisum sativum cultivar Alaska SAT5 mRNA, complete cds.
JMSF048K18Sequence712010484 (8)gb:AY367058_16029187e-71Pisum sativum cultivar Alaska SAT5 mRNA, complete cds.741010484 (8)gb:AY367058_16029185e-84Pisum sativum cultivar Alaska SAT5 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004C10- ATCCCCGGACTTCTTCAATCCCCCTTTTGAATTTTTGGATC
JMFF044P19- GGATC
JMFF014D20- GAATTTTTGGATC
JMSF048K18- CCCCCTTTTGAATTTTTGGATC
                      ____________________________________________________________
consensus ATCCCCGGACTTCTTCAATCCCCCTTTTGAATTTTTGGATC
 
. : . : . : . : . : . :
JMFF004C10- TGAATTTCATCGAATTTTGATCTCCATGGCGAGTTCTGAAGAATCGAGTCCTCTCCTGCC
JMFF044P19- TGAATTTCATCGAATTTTGATCTCCATGGCGAGTTCTGAAGAATCGAGTCCTCTCCTGCC
JMFF014D20- TGAATTTCATCGAATTTTGATCTCCATGGCGAGTTCTGAAGAATCGAGTCCTCTCCTGCC
JMSF048K18- TGAATTTCATCGAATTTTGATCTCCATGGCGAGTTCTGAAGAATCGAGTCCTCTCCTGCC
                      ____________________________________________________________
consensus TGAATTTCATCGAATTTTGATCTCCATGGCGAGTTCTGAAGAATCGAGTCCTCTCCTGCC
 
. : . : . : . : . : . :
JMFF004C10- AAGGCAACAAGAAGCCCAGGCGAAAAATGAGAACAACTCATCGAACCAAGCCGCTCCGGC
JMFF044P19- AAGGCAACAAGAAGCCCAGGCGAAAAATGAGAACAACTCATCGAACCAAGCCGCTCCGGC
JMFF014D20- AAGGCAACAAGAAGCCCAGGCGAAAAATGAGAACAACTCATCGAACCAAGCCGCTCCGGC
JMSF048K18- AAGGCAACAAGAAGCCCAGGCGAAAAATGAGAACAACTCATCGAACCAAGCCGCTCCGGC
                      ____________________________________________________________
consensus AAGGCAACAAGAAGCCCAGGCGAAAAATGAGAACAACTCATCGAACCAAGCCGCTCCGGC
 
. : . : . : . : . : . :
JMFF004C10- CGCCCCAGCTCCTCCGCCGGCTCCGGCGGACACGGTGAAGCCACCCCCGGCTGTTATTCC
JMFF044P19- CGCCCCAGCTCCTCCGCCGGCTCCGGCGGACACGGTGAAGCCACCCCCGGCTGTTATTCC
JMFF014D20- CGCCCCAGCTCCTCCGCCGGCTCCGGCGGACACGGTGAAGCCACCCCCGGCTGTTATTCC
JMSF048K18- CGCCCCAGCTCCTCCGCCGGCTCCGGCGGACACGGTGAAGCCACCCCCGGCTGTTATTCC
rJMSF048K18+ TCC
rJMFF004C10+ TATTCC
                      ____________________________________________________________
consensus CGCCCCAGCTCCTCCGCCGGCTCCGGCGGACACGGTGAAGCCACCCCCGGCTGTTATTCC
 
. : . : . : . : . : . :
JMFF004C10- GATGGGGTGGACCGCCAATGGCCTGCCGTTGAGATACAGCGTGACGGGTGAGCCCGTCGC
JMFF044P19- GATGGGGTGGACCGCCAATGGCCTGCCGTTGAGATACAGCGTGACGGGTGAGCCCGTCGC
JMFF014D20- GGTGGGGTGGACCGCCAATGGCCTGCCGTTGAGATACAGCGTGACGGGTGAGCCCGTCGC
JMSF048K18- GATGGGGTGGACCGCCAATGGCCTGCCGTTGAGATACAGCGTGACGGGTGAGCCCGTCGC
rJMSF048K18+ GATGGGGTGGACCGCCAATGGCCTGCCGTTGAGATACAGCGTGACGGGTGAGCCCGTCGC
rJMFF004C10+ GATGGGGTGGACCGCCAATGNCCTGCCGTTGAGATACAGCGTGACGGGTGAGCCCGTCGC
                      ____________________________________________________________
consensus GATGGGGTGGACCGCCAATGGCCTGCCGTTGAGATACAGCGTGACGGGTGAGCCCGTCGC
 
. : . : . : . : . : . :
JMFF004C10- GGCTAGGGCGCAGTGGGATTCCGGCCTCTGTGCTTGTCTGGGGAGGAATGATGAATTCTG
JMFF044P19- GGCTAGGGCGCAGTGGGATTCCGGCCTCTGTGCTTGTCTGGGGAGGAATGATGAATTCTG
JMFF014D20- GGCTAGGGCGCAGTGGGATTCCGGCCTCTGTGCTTGTCTGGGGAGGAATGATGAATTCTG
JMSF048K18- GGCTAGGGCGCAGTGGGATTCCGGCCTCTGTGCTTGTCTGGGGAGGAATGATGAATTCTG
rJMSF048K18+ GGCTAGGGCGCAGTGGGATTCCGGCCTCTGTGCTTGTCTGGGGAGGAATGATGAATTCTG
rJMFF004C10+ GGCTAGGGCGCAGTGGGATTCCGGCCTCTGTGCTTGTCTGGGGAGGAATGATGAATTCTG
rJMFF014D20+ GGCGCAGTGGGATTCCGGCCTCTGTGCTTGTCTGGGGAGGAATGATGAATTCTG
                      ____________________________________________________________
consensus GGCTAGGGCGCAGTGGGATTCCGGCCTCTGTGCTTGTCTGGGGAGGAATGATGAATTCTG
 
. : . : . : . : . : . :
JMFF004C10- CAGCAGTGATCTTGAAGTTTGTTTTGTTAGGAAGTTTGGCCCCTTGTGTGCTCTACGGAA
JMFF044P19- CAGCAGTGATCTTGAAGTTTG-TTTGTTAGGAAGTTTGGCCCCTTGTGTGCTCTACGGAA
JMFF014D20- CAGCAGTGATCTTGAAGTTTGTTTTGTTGGGAAGTTTGGCCCCTTGTGTGCTCTACGGAA
JMSF048K18- CAGCAGTGATCTTGAAGTTTG-TTTGTTAGGAAGTTTGGCCCCTTGTGTGCTCTACGGAA
rJMSF048K18+ CAGCAGTGATCTTGAAGTTTG-TTTGTTAGGAAGTTTGGCCCCTTGTGTGCTCTACGGAA
rJMFF004C10+ CAGCAGTGATCTTGAAGTTTG-TTTNTTAGGAAGTTTGGCCCCTTGTGTGCTCTACGGAA
rJMFF014D20+ CAGCAGTGATCTTGAAGTTTG-TTTGTTGGGAAGTTTGGCCCCTTGTGTGCTCTACGGAA
rJMFF044P19+ ACGGAA
                      ____________________________________________________________
consensus CAGCAGTGATCTTGAAGTTTG-TTTGTTAGGAAGTTTGGCCCCTTGTGTGCTCTACGGAA
 
. : . : . : . : . : . :
JMFF004C10- CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
JMFF044P19- CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
JMFF014D20- CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
JMSF048K18- CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
rJMSF048K18+ CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
rJMFF004C10+ CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
rJMFF014D20+ CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
rJMFF044P19+ CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
                      ____________________________________________________________
consensus CCAATGTTGAGAGAATTGGTTCTTCCCCGGGGGCTTTCGCCAATCACTGCTTGCCTTACA
 
. : . : . : . : . : . :
JMFF004C10- CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
JMFF044P19- CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
JMFF014D20- CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
JMSF048K18- CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
rJMSF048K18+ CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
rJMFF004C10+ CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
rJMFF014D20+ CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
rJMFF044P19+ CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
                      ____________________________________________________________
consensus CTGGTTTATACCTGATCGGGAATTCGTTTTTTGGTTGGAATTGCCTGGCTCCCTGGTTCT
 
. : . : . : . : . : . :
JMFF004C10- CTTATCCTAGCCGTACCGCCATTC-GCCGCAAGTTCAATTTG
JMFF044P19- CTTATCCTAGCCGTACCGCCATTC-GCCGCAAGTTCAATTTGGAGGGGAGCTGCGAGGCG
JMFF014D20- CTTATCCTAGCCGTACCGCCATTC-GCCGCAAGTTCAATTTGGAGGGGAGCTGCGAGGCG
JMSF048K18- CTTATCCTAGCCGTACCGCCATTC-GCCGCAAGTTCAATTTGGAGGGGAGCTGCGAGGCG
rJMSF048K18+ CTTATCCTAGCCGTACCGCCATTC-GCCGCAAGTTCAATTTGGAGGGGAGCTGCGAGGCG
rJMFF004C10+ CTTATCCTAGCCGTACCGCCATTCNNCCGCAAGTTCAATTTGGAGGGGAGCTGCGAGGCG
rJMFF014D20+ CTTATCCTAGCCGTACCGCCATTC-GCCGCAAGTTCAATTTGGAGGGGAGCTGCGAGGCG
rJMFF044P19+ CTTATCCTAGCCGTACCGCCATTC-GCCGCAAGTTCAATTTGGAGGGGAGCTGCGAGGCG
                      ____________________________________________________________
consensus CTTATCCTAGCCGTACCGCCATTC-GCCGCAAGTTCAATTTGGAGGGGAGCTGCGAGGCG
 
. : . : . : . : . : . :
JMFF044P19- CTTACCAGATCATGTGGGTGTGGTGGGAGCTTTGTGGAAGATGATTTGCAACGCG
JMFF014D20- CTTACCAGATCATGTGGG
JMSF048K18- CTTACCAGATCATGTGGGTGTGGTGGGAGCTTTGTGGAAGATGATTTGCAACGCGAACAG
rJMSF048K18+ CTTACCAGATCATGTGGGTGTGGTGGGAGCTTTGTGGAAGATGATTTGCAACGCGAACAG
rJMFF004C10+ CTTACCAGATCATGTGGGTGTGGTGGGAGCTTTGTGGAAGATGATTTGCAACGCGAACAG
rJMFF014D20+ CTTACCAGATCATGTGGGTGTGGTGGGAGCTTTGTGGAAGATGATTTGCAACGCGAACAG
rJMFF044P19+ CTTACCAGATCATGTGGGTGTGGTGGGAGCTTTGTGGAAGATGATTTGCAACGCGAACAG
                      ____________________________________________________________
consensus CTTACCAGATCATGTGGGTGTGGTGGGAGCTTTGTGGAAGATGATTTGCAACGCGAACAG
 
. : . : . : . : . : . :
JMSF048K18- TGTGAATCTGCTTGTGACTTGGGAACTCACGTCTTTTGCCACCTATGCGCCCTGTGTCAG
rJMSF048K18+ TGTGAATCTGCTTGTGACTTGGGAACTCACGTCTTTTGCCACCTATGCGCCCTGTGTCAG
rJMFF004C10+ TGTGAATCTGCTTGTGACTTGGGAACTCACGTCTTTTGCCACCTATGCGCCCTGTGTCAG
rJMFF014D20+ TGTGAATCTGCTTGTGACTTGGGAACTCACGTCTTTTGCCACCTATGCGCCCTGTGTCAG
rJMFF044P19+ TGTGAATCTGCTTGTGACTTGGGAACTCACGTCTTTTGCCACCTATGCGCCCTGTGTCAG
                      ____________________________________________________________
consensus TGTGAATCTGCTTGTGACTTGGGAACTCACGTCTTTTGCCACCTATGCGCCCTGTGTCAG
 
. : . : . : . : . : . :
JMSF048K18- GAAGCTCGTGAAGTTCGTCGT
rJMSF048K18+ GAAGCTCGTGAAGTTCGTCGTAGGCTTCCCCATCCCGGGTTCAACGCCCAACCCGTCTTG
rJMFF004C10+ GAAGCTCGTGAAGTTCGTCGTAGGCTTCCCCATCCCGGGTTCAACGCCCAACCCGTCTTG
rJMFF014D20+ GAAGCTCGTGAAGTTCGTCGTAGGCTTCCCCATCCCGGGTTCAACGCCCAACCCGTCTTG
rJMFF044P19+ GAAGCTCGTGAAGTTCGTCGTAGGCTTCCCCATCCCGGGTTCAACGCCCAACCCGTCTTG
                      ____________________________________________________________
consensus GAAGCTCGTGAAGTTCGTCGTAGGCTTCCCCATCCCGGGTTCAACGCCCAACCCGTCTTG
 
. : . : . : . : . : . :
rJMSF048K18+ GTCATGATCCCTCCCGGAGAACAGACAATGGGTCGCTAAGCGCAATGATTGTCCATTCAT
rJMFF004C10+ GTCATGATCCCTCCCGGAGAACAGACAATGGGTCGCTAAGCGCAATGATTGTCCATTCAT
rJMFF014D20+ GTCATGATCCCTCCCGGAGAACAGACAATGGGTCGCTAAGCGCAATGATTGTCCATTCAT
rJMFF044P19+ GTCATGATCCCTCCCGGAGAACAGACAATGGGTCGCTAAGCGCAATGATTGTCCATTCAT
                      ____________________________________________________________
consensus GTCATGATCCCTCCCGGAGAACAGACAATGGGTCGCTAAGCGCAATGATTGTCCATTCAT
 
. : . : . : . : . : . :
rJMSF048K18+ AGATATGGTTCTGCATTACCTGATTGTTGTTCTTCTATTGCCAATTAAGCCTGCACTGAG
rJMFF004C10+ AGATATGGTTCTGCATTACCTGATTGTTGTTCTTCTATTGCCAATTAAGCCTGCACTGAG
rJMFF014D20+ AGATATGGTTCTGCATTACCTGATTGTTGTTCTTCTATTGCCAATTAAGCCTGCACTGAG
rJMFF044P19+ AGATATGGTTCTGCATTACCTGATTGTTGTTCTTCTATTGCCAATTAAGCCTGCACTGAG
                      ____________________________________________________________
consensus AGATATGGTTCTGCATTACCTGATTGTTGTTCTTCTATTGCCAATTAAGCCTGCACTGAG
 
. : . : . : . : . : . :
rJMSF048K18+ TATACTTTCTTTGTCTTTTTAGATCATCATATTTATAAATAAGACATGTATCATTTTAGT
rJMFF004C10+ TATACTTTCTTTGTCTTTTTAGATCATCATATTTATAAATAAGACATGTATCATTTTAGT
rJMFF014D20+ TATACTTTCTTTGTCTTTTTAGATCATCATATTTATAAATAAGACATGTATCATTTTAGT
rJMFF044P19+ TATACTTTCTTTGTCTTTTTAGATCATCATATTTATAAATAAGACATGTATCATTTTAGT
                      ____________________________________________________________
consensus TATACTTTCTTTGTCTTTTTAGATCATCATATTTATAAATAAGACATGTATCATTTTAGT
 
. : . : . : . : . : . :
rJMSF048K18+ ACCATATGGGTT
rJMFF004C10+ ACCATATGGGTTCAACGTATGAATTACACAAAGT
rJMFF014D20+ ACCATATGGGTTCAACGTATGAATTACACAAAG-TGGAA
rJMFF044P19+ ACCATATGGGTTCAACGTATGAATTACACAAAGTTGGAATAAAGAAGATTGTTTCTGTCC
                      ____________________________________________________________
consensus ACCATATGGGTTCAACGTATGAATTACACAAAGTTGGAATAAAGAAGATTGTTTCTGTCC