Previous Contig 010475:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001C09Sequence514010475 (15)pir|S40404|S404043e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat212010475 (15)gb:D49485_16746210.001Solidago altissima clone SAcSODcy mRNA for copper/zinc-superoxide dismutase, com
JMFF013E23Sequence518010475 (15)pir|S40404|S404043e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat686010475 (15)pir|S40404|S404041e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat
JMFF015D12Sequence519010475 (15)pir|S40404|S404044e-79superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat656010475 (15)pir|S40404|S404041e-79superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat
JMFF023O14Sequence352001158 (3)gb:ATT22E16_15552524e-22Arabidopsis thaliana DNA chromosome 3, BAC clone T22E16.731010475 (15)pir|S40404|S404041e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat
JMFF024I12Sequence720010475 (15)pir|S40404|S404041e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat
JMFF026G14Sequence627010475 (15)pir|S40404|S404041e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat674010475 (15)pir|S40404|S404041e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat
JMFF026G22Sequence509010475 (15)pir|S40404|S404045e-78superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat674010475 (15)pir|S40404|S404043e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat
JMFF044F24Sequence646010475 (15)pir|S40404|S404041e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat614021703pir|S40404|S404044e-67superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat
JMFF044O09Sequence646010475 (15)pir|S40404|S404041e-80superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat585010475 (15)pir|S40404|S404043e-67superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF026G22- ACTTTG
JMFF013E23- ACTTTG
JMFF015D12- ACTTTG
JMFF044O09- ACTTTG
JMFF001C09- G
JMFF026G14- CTTTG
JMFF044F24- ACTTTG
rJMFF015D12+ ACTTTG
                      ____________________________________________________________
consensus ACTTTG
 
. : . : . : . : . : . :
JMFF026G22- ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
JMFF013E23- ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
JMFF015D12- ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
JMFF044O09- ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
JMFF001C09- ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
JMFF026G14- ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
JMFF044F24- ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
rJMFF015D12+ ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
rJMFF026G22+ GTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
rJMFF026G14+ TCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
rJMFF013E23+ TCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
                      ____________________________________________________________
consensus ACTTCATACTTCACTCTCTCTCAGTCTTTCAAGGGGTGCTCTGAGATCACAAACAAAAAT
 
. : . : . : . : . : . :
JMFF026G22- GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
JMFF013E23- GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
JMFF015D12- GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
JMFF044O09- GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
JMFF001C09- GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
JMFF026G14- GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
JMFF044F24- GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
rJMFF015D12+ GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
rJMFF026G22+ GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
rJMFF026G14+ GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
rJMFF013E23+ GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
                      ____________________________________________________________
consensus GGTGAAGGGTGTGGCAGTTCTTAGCAGCAGTGAAGGTGTCAGCGGCACCATTTTCTTCAC
 
. : . : . : . : . : . :
JMFF026G22- CCAAGAAGGAGATGGTCCAACCACAGTCACTGGGAATGTTTCGGGCCTCAAACCTGGTCA
JMFF013E23- CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
JMFF015D12- CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
JMFF044O09- CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
JMFF001C09- CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
JMFF026G14- CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
JMFF044F24- CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
rJMFF015D12+ CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
rJMFF026G22+ CCAAGAAGGAGATGGTCCAACCACAGTCACTGGGAATGTTTCGGGCCTCAAACCTGGTCA
rJMFF026G14+ CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
rJMFF024I12+ CCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
rJMFF023O14+ CCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
rJMFF013E23+ CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
rJMFF044O09+ TCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
                      ____________________________________________________________
consensus CCAAGAAGGAGATGGTCCAACCACAGTCACTGGAAATGTTTCGGGCCTCAAACCTGGTCA
 
. : . : . : . : . : . :
JMFF026G22- TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
JMFF013E23- TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
JMFF015D12- TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
JMFF044O09- TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
JMFF001C09- TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
JMFF026G14- TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
JMFF044F24- TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
rJMFF015D12+ TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
rJMFF026G22+ TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
rJMFF026G14+ TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
rJMFF024I12+ TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
rJMFF023O14+ TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
rJMFF013E23+ TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
rJMFF044O09+ TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
                      ____________________________________________________________
consensus TCATGGATTCCATGTCCATGCCCTAGGTGACACAACAAATGGATGCATGTCTACTGGACC
 
. : . : . : . : . : . :
JMFF026G22- ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
JMFF013E23- ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
JMFF015D12- ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
JMFF044O09- ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
JMFF001C09- ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
JMFF026G14- ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
JMFF044F24- ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
rJMFF015D12+ ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
rJMFF026G22+ ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
rJMFF026G14+ ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
rJMFF024I12+ ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
rJMFF023O14+ ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
rJMFF013E23+ ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
rJMFF044O09+ ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
                      ____________________________________________________________
consensus ACATTTCAATCCTGCTGGAAAGGAGCATGGAGCTCCTGAAGACGATATCCGCCATGCCGG
 
. : . : . : . : . : . :
JMFF026G22- TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACGA
JMFF013E23- TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
JMFF015D12- TGATCTTGGAAACATCACGGTTGGAGAAGATGTTACTGCTACATTCACTATCACTGACAA
JMFF044O09- TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
JMFF001C09- TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
JMFF026G14- TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
JMFF044F24- TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
rJMFF015D12+ TGATCTTGGAAACATCACGGTTGGAGAAGATGTTACTGCTACATTCACTATCACTGACAA
rJMFF026G22+ TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACGA
rJMFF026G14+ TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
rJMFF024I12+ TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
rJMFF023O14+ TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
rJMFF013E23+ TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
rJMFF044O09+ TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
                      ____________________________________________________________
consensus TGATCTTGGAAACATCACGGTTGGAGAAGATGGTACTGCTACATTCACTATCACTGACAA
 
. : . : . : . : . : . :
JMFF026G22- ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
JMFF013E23- ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
JMFF015D12- ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
JMFF044O09- ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
JMFF001C09- ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
rJMFF001C09+ TGGAGCANATTCTATTATANGAAGANCTGTTGTTGTTCATGGTGA
JMFF026G14- ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
JMFF044F24- ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
rJMFF015D12+ ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
rJMFF026G22+ ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
rJMFF026G14+ ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
rJMFF024I12+ ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
rJMFF023O14+ ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
rJMFF013E23+ ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
rJMFF044O09+ ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
                      ____________________________________________________________
consensus ACAGATTCCGCTTACTGGAGCAAATTCTATTATTGGAAGAGCTGTTGTTGTTCATGGTGA
 
. : . : . : . : . : . :
JMFF026G22- TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
JMFF013E23- TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
JMFF015D12- TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
JMFF044O09- TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
JMFF001C09- TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
rJMFF001C09+ TCNTGATGATNNTGGCAAAGGTGNCCANGAACTCAGCAAAACCACTGGAAATNATGGTGG
JMFF026G14- TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
JMFF044F24- TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
rJMFF015D12+ TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
rJMFF026G22+ TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
rJMFF026G14+ TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
rJMFF024I12+ TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
rJMFF023O14+ TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
rJMFF013E23+ TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
rJMFF044O09+ TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
                      ____________________________________________________________
consensus TCCTGATGATCTTGGCAAAGGTGGCCATGAACTCAGCAAAACCACTGGAAATGCTGGTGG
 
. : . : . : . : . : . :
JMFF026G22- GAGGGTTGCCTGCGGTATCATTG
JMFF013E23- GAGGGTTGCCTGCGGTATCATTGGCCTGCAGG
JMFF015D12- GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGG
JMFF044O09- GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
JMFF001C09- GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGG
rJMFF001C09+ GAGGGTTGCNTGCGGTATCATTGNCNTGCAGGNTTAAGAGAGTTATNTGCTTANNAATTC
JMFF026G14- GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
JMFF044F24- GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
rJMFF015D12+ GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
rJMFF026G22+ GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
rJMFF026G14+ GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
rJMFF024I12+ GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
rJMFF023O14+ GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
rJMFF013E23+ GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
rJMFF044O09+ GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
                      ____________________________________________________________
consensus GAGGGTTGCCTGCGGTATCATTGGCCTGCAGGGTTAAGAGAGTTATTTGCTTATGAATTC
 
. : . : . : . : . : . :
JMFF044O09- AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
rJMFF001C09+ AGCCATGGCAGAGAGGAAAAAGNTTGAATAAAGGATTCATTTTGCCC
JMFF026G14- AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
JMFF044F24- AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
rJMFF015D12+ AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
rJMFF026G22+ AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
rJMFF026G14+ AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
rJMFF024I12+ AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
rJMFF023O14+ AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
rJMFF013E23+ AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
rJMFF044O09+ AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
                      ____________________________________________________________
consensus AGCCATGGCAGAGAGGAAAAAGCTTGAATAAAGGATTCATTTTGCCCAGTGCTTTTTCTG
 
. : . : . : . : . : . :
JMFF044O09- TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGA
JMFF026G14- TGTTTTTGAACTTCACTCCTT
JMFF044F24- TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGA
rJMFF015D12+ TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGATAGAAACTTT
rJMFF026G22+ TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGATAGAAACTTTGATATGTATG
rJMFF026G14+ TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGATAGAAACTTTGATATGTATG
rJMFF024I12+ TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGATAGAAACTTTGATATGTATG
rJMFF023O14+ TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGATAGAAACTTTGATATGTATG
rJMFF013E23+ TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGATAGAAACTTTGATATGTATG
rJMFF044O09+ TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGATAGAAACTTTGATATGTATG
                      ____________________________________________________________
consensus TGTTTTTGAACTTCACTCCTTGACCAACTCTTATGGGGGATAGAAACTTTGATATGTATG
 
. : . : . : . : . : . :
rJMFF026G22+ ACTGTTTATTATGGCACTTCATTTTGCCTAATTACTA
rJMFF026G14+ ACTGTTTATTATGGCACTTCATTTTGCCTAATTACTAC
rJMFF024I12+ ACTGTTTATTATGGCACTTCATTTTGCCTAATTACTAC
rJMFF023O14+ ACTGTTTATTATGGCACTTCATTTTGCCTAATTACTAC
rJMFF013E23+ ACTGTTTATTATGGCACTTCATTTTGCCTAATTACTACCTGAAAATTAAG
rJMFF044O09+ ACTGTTTATTATGGCACTTCATTTTGCCTAATTACTACCTGAAAATTAAGTTGGTTTGCG
                      ____________________________________________________________
consensus ACTGTTTATTATGGCACTTCATTTTGCCTAATTACTACCTGAAAATTAAGTTGGTTTGCG