Previous Contig 010470:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004A03Sequence583000171 (5)gb:AC134933_17419761e-25Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq767010470 (7)gb:AC134933_17419763e-85Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq
JMFF010E08Sequence634000171 (5)gb:AC134933_17419761e-35Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq719010470 (7)gb:AC134933_17419763e-85Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq
JMFF022C23Sequence533000171 (5)gb:AC134933_17419768e-16Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq742010470 (7)gb:AC134933_17419761e-90Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq
JMFF044N22Sequence646000171 (5)gb:AC134933_17419763e-38Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq654010470 (7)gb:AC134933_17419762e-65Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq
JMSF032I08Sequence676000171 (5)gb:AC134933_17419765e-41Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq811010470 (7)gb:AC134933_1741976e-100Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq
JMSF049O16Sequence493010470 (7)gb:AC134933_17419765e-45Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq444010470 (7)gb:AC134933_17419764e-45Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032I08+ ACTTCAAATGGTCC
                      ____________________________________________________________
consensus ACTTCAAATGGTCC
 
. : . : . : . : . : . :
rJMSF032I08+ AGAGTTGACTGGGTGCTGTGAGCAAAATCCACCCACTTTCTGATGCTTATAAGGTGTTGA
                      ____________________________________________________________
consensus AGAGTTGACTGGGTGCTGTGAGCAAAATCCACCCACTTTCTGATGCTTATAAGGTGTTGA
 
. : . : . : . : . : . :
rJMSF032I08+ GAAAAGATGATATCATTCTCTCATTTGATGGCATACCTATAGCCAATGACGGAACAGTTC
rJMFF010E08+ ACGGAACAGTTC
rJMFF022C23+ TATAGCCAATGACGGAACAGTTC
rJMFF004A03+ AAAGATGATATCATTCTCTCATTTGATGNCATAGNTATAGCCAATGACGGANCAGTTC
                      ____________________________________________________________
consensus GAAAAGATGATATCATTCTCTCATTTGATGGCATAGCTATAGCCAATGACGGAACAGTTC
 
. : . : . : . : . : . :
rJMSF032I08+ ATTTTCGAAACAGAGAGCGAATAACATTTGATCACTTGGTTTCTATGAAGAAACCTAATG
rJMFF010E08+ ATTTTCGAAACAGAGAGCGAATAACATTTGATCACTTGGTTTNTATGAAGAAACCTAATG
rJMFF022C23+ ATTTTCGAAACAGAGAGCGAATAACATTTGATCACTTGGTTTCTATGAAGAAACCTAATG
rJMFF004A03+ ATTTTCGAACCAGAGAGCGAATAACATTTGATCACTTGGTTTCTATGAAGAAACCTAATG
                      ____________________________________________________________
consensus ATTTTCGAAACAGAGAGCGAATAACATTTGATCACTTGGTTTCTATGAAGAAACCTAATG
 
. : . : . : . : . : . :
rJMSF032I08+ AAACTGCAGTACTCAAAGTACTGAGAAATGGTGAGAAGCATGAGTTTAGCATCAAACTTT
rJMFF010E08+ AAACTGCAGTACTCAAAGTACTGAGAAATGGTGAGAAGCATGAGTTTAGCATCAAACTTT
rJMFF022C23+ AAACTGCAGTACTCAAAGTACTGAGAAATGGTGAGAAGCATGAGTTTAGCATCAAACTTT
rJMFF004A03+ AAACTGCAGTACTCAAAGTACTGAGAAATGGTGAGAAGCANGAGTTTAGCATCAAACTTT
                      ____________________________________________________________
consensus AAACTGCAGTACTCAAAGTACTGAGAAATGGTGAGAAGCATGAGTTTAGCATCAAACTTT
 
. : . : . : . : . : . :
rJMSF032I08+ TTCCACTGAAACCCCTTGTTCCGGTTCATCAATTTGATAAGCTTCCCAGTTTTTTCATTT
rJMFF010E08+ TTCCACTGAAACCCCTTGTTCCGGTTCATCAATTTGATAAGCTTCCCAGTTTTTTCATTT
rJMFF022C23+ TTCCACTGAAACCCCTTGTTCCGGTTCATCAATTTGATAAGCTTCCCAGTTTTTTCATTT
rJMFF004A03+ TTCCACTGAAACCCCTTGTTCCGGTTCATCAATTTGATAAGCTTCCCAGTTTTTTCATTT
rJMFF044N22+ TGAAACCCCTTGTTCCGGTTCATCAATTTGATAAGCTTCCCAGTTTTTTCATTT
                      ____________________________________________________________
consensus TTCCACTGAAACCCCTTGTTCCGGTTCATCAATTTGATAAGCTTCCCAGTTTTTTCATTT
 
. : . : . : . : . : . :
rJMSF049O16+ AGACT
rJMSF032I08+ TTGCTGGTCTTGTCTTCATTCCTTTAACTCAACCATACCTTCATGAGTATGGAGAAGACT
rJMFF010E08+ TTGCTGGTCTTGTCTTCATTCCTTTAACTCAACCATACCTTCATGAGTATGGAGAAGACT
rJMFF022C23+ TTGCTGGTCTTGTCTTCATTCCTTTAACTCAACCATACCTTCATGAGTATGGAGAAGACT
rJMFF004A03+ TTGCTGGTCTTGTCTTCATTCCTTTAACTCAACCATACCTTCATGAGTATGGAGAAGACT
JMSF049O16- AGACT
rJMFF044N22+ TTGCTGGTCTTGTCTTCATTCCTTTAACTCAACCATACCTTCATGAGTATGGAGAAGACT
                      ____________________________________________________________
consensus TTGCTGGTCTTGTCTTCATTCCTTTAACTCAACCATACCTTCATGAGTATGGAGAAGACT
 
. : . : . : . : . : . :
rJMSF049O16+ GGTACAATACCTCACCTCGGCGGTTGTGTGAAAGAGCACTTAGGAAACTTCCAACAAAAC
rJMSF032I08+ GGTACAATACCTCACCTCGGCGGTTGTGTGAAAGAGCACTCAGGAAACTTCCAACAAAAC
rJMFF010E08+ GGTACAATACCTCACCTCGGCGGTTGTGTGAAAGAGCACTCAGGAAACTTCCAACAAAAC
rJMFF022C23+ GGTACAATACCTCACCTCGGCGGTTGTGTGAAAGAGCACTCAGGAAACTTCCAACAAAAC
rJMFF004A03+ GGTACAATACCTCACCTCGGCGGTTGTGTGAAAGAGCACTCAGGAAACTTCCAACAAAAC
JMSF049O16- GGTACAATACCTCACCTCGGCGGTTGTGTGAAAGAGCACTTAGGAAACTTCCAACAAAAC
rJMFF044N22+ GGTACAATACCTCACCTCGGCGGTTGTGTGAAAGAGCACTCAGGAAACTTCCAACAAAAC
                      ____________________________________________________________
consensus GGTACAATACCTCACCTCGGCGGTTGTGTGAAAGAGCACTCAGGAAACTTCCAACAAAAC
 
. : . : . : . : . : . :
rJMSF049O16+ CTGGAGAACAACTTGTTATTCTTTCTCAGGTCTTGTTAGATGATATTAATACTGGGTATG
rJMSF032I08+ CTGGAGAACAACTTGTTATTCTTTCTCAGGTCTTGTTAGATGATATTAATACTGGGTATG
rJMFF010E08+ CTGGAGAACAACTTGTTATTCTTTCTCAGGTCTTGTTAGATGATATTAATACTGGGTATG
rJMFF022C23+ CTGGAGAACAACTTGTTATTCTTTCTCAGGTCTTGTTAGATGATATTAATACTGGGTATG
rJMFF004A03+ CTGGAGAACAACTTGTTATTCTTTCTCAGGTCTTGTTAGATGATATTAATACTGGGTATG
JMSF049O16- CTGGAGAACAACTTGTTATTCTTTCTCAGGTCTTGTTAGATGATATTAATACTGGGTATG
rJMFF044N22+ CTGGAGAACAACTTGTTATTCTTTCTCAGGTCTTGTTAGATGATATTAATACTGGGTATG
                      ____________________________________________________________
consensus CTGGAGAACAACTTGTTATTCTTTCTCAGGTCTTGTTAGATGATATTAATACTGGGTATG
 
. : . : . : . : . : . :
rJMSF049O16+ AGCGTCTTGCAGAATTGCAGGTCAATAAGGTTAATGGTGTTGAAGTTGAGAATTTGAAAC
rJMSF032I08+ AGCGTCTTGCAGAATTGCAGGTCAATAAGGTTAATGGTGTTGAAGTTGAGAATTTGAAAC
rJMFF010E08+ AGCGTCTTGCAGAATTGCAGGTCAATAAGGTTAATGGTGTTGAAGTTGAGAATTTGAAAC
rJMFF022C23+ AGCGTCTTGCAGAATTGCAGGTCAATAAGGTTAATGGTGTTGAAGTTGAGAATTTGAAAC
rJMFF004A03+ AGCGTCTTGCAGAATTGCAGGTCAATAAGGTTAATGGTGTTGAAGTTGAGAATTTGAAAC
JMSF049O16- AGCGTCTTGCAGAATTGCAGGTCAATAAGGTTAATGGTGTTGAAGTTGAGAATTTGAAAC
rJMFF044N22+ AGCGTCTTGCAGAATTGCAGGTCAATAAGGTTAATGGTGTTGAAGTTGAGAATTTGAAAC
                      ____________________________________________________________
consensus AGCGTCTTGCAGAATTGCAGGTCAATAAGGTTAATGGTGTTGAAGTTGAGAATTTGAAAC
 
. : . : . : . : . : . :
rJMSF049O16+ ACTTACGCAAGCTTGTGGAGGATAATAGCAAAGAGAGAATAAGGTTCGATCTGGATGATG
rJMSF032I08+ ACTTACGCAAGCTTGTGGAGGATAATAGCAAAGAGAGAATAAGGTTCGATCTGGATGATG
rJMFF010E08+ ACTTACGCAAGCTTGTGGAGGATAATAGCAAAGAGAGAATAAGGTTCGATCTGGATGATG
rJMFF022C23+ ACTTACGCAAGCTTGTGGAGGATAATAGCAAAGAGAGAATAAGGTTCGATCTGGATGATG
rJMFF004A03+ ACTTACGCAAGCTTGTGGAGGATAATAGCAAAGAGAGAATAAGGTTCGATCTGGATGATG
JMSF049O16- ACTTACGCAAGCTTGTGGAGGATAATAGCAAAGAGAGAATAAGGTTCGATCTGGATGATG
rJMFF044N22+ ACTTACGCAAGCTTGTGGAGGATAATAGCAAAGAGAGAATAAGGTTCGATCTGGATGATG
                      ____________________________________________________________
consensus ACTTACGCAAGCTTGTGGAGGATAATAGCAAAGAGAGAATAAGGTTCGATCTGGATGATG
 
. : . : . : . : . : . :
rJMSF049O16+ AGAGGGTGATTGTTTTGAACTACGATTTGGCAAAAGTAGCCACTTCCCGTATACTAAAAC
rJMSF032I08+ AGAGGGTGATTGTTTTGAACTACGATTTGGCAAAAGTAGCCACTTCCCGTATACTAAAAC
rJMFF010E08+ AGAGGGTGATTGTTTTGAACTACGATTTGGCAAAAGTAGCCACTTCCCGTATACTAAAAC
rJMFF022C23+ AGAGGGTGATTGTTTTGAACTACGATTTGGCAAAAGTAGCCACTTCCCGTATACTAAAAC
rJMFF004A03+ AGAGGGTGATTGTTTTGAACTACGATTTGGCAAAAGTAGCCACTTCCCGTATACTAAAAC
JMSF049O16- AGAGGGTGATTGTTTTGAACTACGATTTGGCAAAAGTAGCCACTTCCCGTATACTAAAAC
rJMFF044N22+ AGAGGGTGATTGTTTTGAACTACGATTTGGCAAAAGTAGCCACTTCCCGTATACTAAAAC
                      ____________________________________________________________
consensus AGAGGGTGATTGTTTTGAACTACGATTTGGCAAAAGTAGCCACTTCCCGTATACTAAAAC
 
. : . : . : . : . : . :
rJMSF049O16+ GCCATAGAATACCTTATGCTATGTCTAGTGATCTTATCAATGATGAATGTGCACCTGCAC
rJMSF032I08+ GCCATAGAATACCTTATGCTATGTCTAGTGATCTTATCAATGATGAATGTGCACCTGCAC
rJMFF010E08+ GCCATAGAATACCTTATGCTATGTCTAGTGATCTTATCAATGATGAATGTGCACCTGCAC
rJMFF022C23+ GCCATAGAATACCTTATGCTATGTCTAGTGATCTTATCAATGATGAATGTGCACCTGCAC
rJMFF004A03+ GCCATAGAATACCTTATGCTATGTCTAGTGATCTTATCAATGATGAATGTGCACCTGCAC
JMSF049O16- GCCATAGAATACCTTATGCTATGTCTAGTGATCTTATCAATGATGAATGTGCACCTGCAC
rJMFF044N22+ GCCATAGAATACCTTATGCTATGTCTAGTGATCTTATCAATGATGAATGTGCACCTGCAC
                      ____________________________________________________________
consensus GCCATAGAATACCTTATGCTATGTCTAGTGATCTTATCAATGATGAATGTGCACCTGCAC
 
. : . : . : . : . : . :
rJMSF049O16+ TTGAGTTGGCTTGCTCAAACTGATTTTTCTTCAAACTTCTATTCTTTCTTACTGAAATTT
rJMSF032I08+ TTGAGTTGGCTTGCTCAAACTGATTTTTCTTCAAACTTCTATTCTTTCTTACTGAAATTT
rJMFF010E08+ TTGAGTTGGCTTGCTCAAACTGATTTTTCTTCAAACTTCTATTCTTTCTTACTGAAATTT
rJMFF022C23+ TTGAGTTGGCTTGCTCAAACTGATTTTTCTTCAAACTTCTATTCTTTCTTACTGAAATTT
rJMFF004A03+ TTGAGTTGGCTTGCTCAAACTGATTTTTCTTCAAACTTCTATTCTTTCTTACTGAAATTT
JMSF049O16- TTGAGTTGGCTTGCTCAAACTGATTTTTCTTCAAACTTCTATTCTTTCTTACTGAAATTT
rJMFF044N22+ TTGAGTTGGCTTGCTCAAACTGATTTTTCTTCAAACTTCTATTCTTTCTTACTGAAATTT
                      ____________________________________________________________
consensus TTGAGTTGGCTTGCTCAAACTGATTTTTCTTCAAACTTCTATTCTTTCTTACTGAAATTT
 
. : . : . : . : . : . :
rJMSF049O16+ TGTA-TTTAAAAACTCAC
rJMSF032I08+ TGTA-TTTAAAAACTCAC
rJMFF010E08+ TGTATTTTAAAAACTCACCATTTCAGTTATTAAATCTTAGAATATAA
rJMFF022C23+ TGTATTTTAAAAACTCACCATTTCAGTTATTAAATCTTAGAATATAAT
rJMFF004A03+ TGTATTTTAAAAACTCACCATTTCAGTTATTAAATCTTAGAATATAAT
JMSF049O16- TGTATTTTAAAAACTCACCATTTCAGTTATTAAATCTTAGAATATAATCTCTATGCA
rJMFF044N22+ TGTATTTTAAAAACTCACCATTTCAGTTATTAAATCTTAGAATATAATCTCTATGCATTG
                      ____________________________________________________________
consensus TGTATTTTAAAAACTCACCATTTCAGTTATTAAATCTTAGAATATAATCTCTATGCATTG
 
. : . : . : . : . : . :
rJMFF044N22+ GCTGAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GCTGAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG