Previous Contig 010459:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010J22Sequence563003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g727010459 (28)pir|A84649|A846492e-35probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF015J02Sequence558010459 (28)gb:AY485830_16085072e-37Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA, complete cds.>gb:632010459 (28)pir|A84649|A846494e-26probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF020K01Sequence623010459 (28)pir|A84649|A846492e-26probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF021M09Sequence570003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g593010459 (28)pir|A84649|A846498e-16probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF034H15Sequence604010459 (28)pir|A84649|A846499e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF039E22Sequence631010459 (28)gb:AY485830_16085073e-37Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA, complete cds.>gb:735010459 (28)pir|A84649|A846492e-35probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF039F16Sequence477010459 (28)gb:AY485830_16085072e-37Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA, complete cds.>gb:278010459 (28)pir|A84649|A846490.003probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF042I04Sequence653003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g593010459 (28)pir|A84649|A846496e-19probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF044M02Sequence648003368 (25)pir|T08604|T086042e-59hypothetical protein GRR1 - soybean>gb:AF019910_1761610 Glycine max grr1 (grr1) 599010459 (28)pir|A84649|A846493e-15probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF046M11Sequence649003368 (25)pir|A84649|A846497e-19probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g446010459 (28)pir|A84649|A846490.003probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF048M07Sequence447003368 (25)pir|A84649|A846493e-12probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g360010459 (28)
JMFN011F07Sequence503010459 (28)pir|A84649|A846492e-11probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFN029H05Sequence617010459 (28)pir|A84649|A846495e-19probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFN031K17Sequence612010459 (28)pir|A84649|A846497e-58probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFN039N07Sequence627010459 (28)pir|A84649|A846493e-55probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFN039N09Sequence625010459 (28)pir|A84649|A846494e-26probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFN041D18Sequence629010459 (28)pir|A84649|A846494e-26probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFN041F23Sequence624010459 (28)pir|A84649|A846495e-25probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS087B01Sequence627010459 (28)pir|A84649|A846491e-66probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS103B11Sequence602010459 (28)pir|A84649|A846495e-34probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMSF005A19Sequence325010459 (28)
JMSF008O23Sequence304003368 (25)730010459 (28)gb:AY485830_16085075e-37Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA, complete cds.>gb:
JMSF033P11Sequence619003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g724010459 (28)pir|A84649|A846492e-35probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMSF037P20Sequence622003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g719010459 (28)pir|A84649|A846492e-35probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMSF046L15Sequence473003368 (25)pir|A84649|A846494e-05probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g628010459 (28)pir|A84649|A846491e-24probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS087B01- GAATTGCGA
                      ____________________________________________________________
consensus GAATTGCGA
 
. : . : . : . : . : . :
JMFS087B01- GTCTTTTCTCATCAGCCGGTAACCATCTTATGAAGGTCAAGCTCCAGTCGTTGAACATCA
                      ____________________________________________________________
consensus GTCTTTTCTCATCAGCCGGTAACCATCTTATGAAGGTCAAGCTCCAGTCGTTGAACATCA
 
. : . : . : . : . : . :
JMFS087B01- GTGACATCTCTCTAGCTGTTATTGGACATTATGGTGTTGCGTTGACTGACCTAGCCCTAA
                      ____________________________________________________________
consensus GTGACATCTCTCTAGCTGTTATTGGACATTATGGTGTTGCGTTGACTGACCTAGCCCTAA
 
. : . : . : . : . : . :
JMFS087B01- TTAATCTTCAAAACATAAACGAGAGGGGCTTCTGGGTCATGGGTTCCGGTCAAGGTTTAC
                      ____________________________________________________________
consensus TTAATCTTCAAAACATAAACGAGAGGGGCTTCTGGGTCATGGGTTCCGGTCAAGGTTTAC
 
. : . : . : . : . : . :
JMFS087B01- ACAAGTTGAGGTCCCTCGTGATAACCGCTTGCCAAGGAGTTACGGATTTGGGGATTGAAG
JMFN031K17- AG
                      ____________________________________________________________
consensus ACAAGTTGAGGTCCCTCGTGATAACCGCTTGCCAAGGAGTTACGGATTTGGGGATTGAAG
 
. : . : . : . : . : . :
JMFS087B01- CTGTCAGTAAAGGCTGCCCAAACGTGAAACAACTTTGCCTCCGAAAATGTACTCTTCTGT
JMFN031K17- CTGTCAGTAAAGGCTGCCCAAACGTGAAACAACTTTGCCTCCGAAAATGTACTCTTCTGT
                      ____________________________________________________________
consensus CTGTCAGTAAAGGCTGCCCAAACGTGAAACAACTTTGCCTCCGAAAATGTACTCTTCTGT
 
. : . : . : . : . : . :
JMFS087B01- CTGACAATGGTGTGGTTTCTTTCGTTAAAGCTGCAGAGTCAATTGAGAGCCTGCAGTTAG
JMFN031K17- CTGACAATGGTGTGGTTTCTTTCGTTAAAGCTGCAGAGTCAATTGAGAGCCTGCAGTTAG
JMFN039N07- AATTGAGAGCCTGCAGTTAG
                      ____________________________________________________________
consensus CTGACAATGGTGTGGTTTCTTTCGTTAAAGCTGCAGAGTCAATTGAGAGCCTGCAGTTAG
 
. : . : . : . : . : . :
JMFS087B01- AGGAATGCCACCGGATCAGCCAGGCAGGGGTTTTCGGTATTCTTGTACACTCTGCTGGGA
JMFN031K17- AGGAATGCCACCGGATCAGCCAGGCAGGGGTTTTCGGTATTCTTGTACACTCTGCTGGGA
JMFN039N07- AGGAATGCCACCGGATCAGCCAGGCAGGGGTTTTCGGTATTCTTGTACACTCTGCTGGGA
                      ____________________________________________________________
consensus AGGAATGCCACCGGATCAGCCAGGCAGGGGTTTTCGGTATTCTTGTACACTCTGCTGGGA
 
. : . : . : . : . : . :
JMFS087B01- AACTGAAGGCTCTTGCTTTCGAGAACTGTTTTGGAATGAAGGATTTGGCATTTGGGGTTC
JMFN031K17- AACTGAAGGCTCTTGCTTTCGAGAACTGTTTTGGAATGAAGGATTTGGCATTTGGGGTTC
JMFN039N07- AACTGAAGGCTCTTGCTTTCGAGAACTGTTTTGGAATGAAGGATTTGGCATTTGGGGTTC
                      ____________________________________________________________
consensus AACTGAAGGCTCTTGCTTTCGAGAACTGTTTTGGAATGAAGGATTTGGCATTTGGGGTTC
 
. : . : . : . : . : . :
JMFS087B01- CGGCATTGCCTCCTTGCAATTCTCTAAGATCTTTGTCAATTTGTAACTGCACTGGATTCG
JMFN031K17- CGGCATTGCCTCCTTGCAATTCTCTAAGATCTTTGTCAATTTGTAACTGCACTGGATTCG
JMFN039N07- CGGCATTGCCTCCTTGCAATTCTCTAAGATCTTTGTCAATTTGTAACTGCACTGGATTCG
                      ____________________________________________________________
consensus CGGCATTGCCTCCTTGCAATTCTCTAAGATCTTTGTCAATTTGTAACTGCACTGGATTCG
 
. : . : . : . : . : . :
JMFS087B01- GTGATGCTAGCTTGGTCGTTTTGAGTCGACTTTGCCCTAACCTCGTGCATTTGAACCTCA
JMFN031K17- GTGATGCTAGCTTGGTCGTTTTGAGTCGACTTTGCCCTAACCTCGTGCATTTGAACCTCA
JMFN039N07- GTGATGCTAGCTTGGTCGTTTTGAGTCGACTTTGCCCTAACCTCGTGCATTTGAACCTCA
                      ____________________________________________________________
consensus GTGATGCTAGCTTGGTCGTTTTGAGTCGACTTTGCCCTAACCTCGTGCATTTGAACCTCA
 
. : . : . : . : . : . :
JMFS087B01- GTGGCCTTAATGGCGTTA
JMFN031K17- GTGGCCTTAATGGCGTTACCGATTACGGGCTTCTCCCCTTTGTCCAGAGCTGCGATGCCG
JMFN039N07- GTGGCCTTAATGGCGTTACCGATTACGGGCTTCTCCCCTTTGTCCAGAGCTGCGATGCCG
JMFF039F16- CGTTACCGATTACGGGCTTCTCCCCTTTGTCCAGAGCTGCGATGCCG
JMFF015J02- CGTTACCGATTACGGGCTTCTCCCCTTTGTCCAGAGCTGCGATGCCG
JMFF039E22- CGTTACCGATTACGGGCTTCTCCCCTTTGTCCAGAGCTGCGATGCCG
rJMSF008O23+ TACCGATTACGGGCTTCTCCCCTTTGTCCAGAGCTGCGATGCCG
rJMSF033P11+ TTGTCCAGAGCTGCGATGCCG
rJMSF037P20+ GTCCAGAGCTGCGATGCCG
rJMFF010J22+ TCCAGAGCTGCGATGCCG
rJMFF039E22+ GCTGCGATGCCG
                      ____________________________________________________________
consensus GTGGCCTTAATGGCGTTACCGATTACGGGCTTCTCCCCTTTGTCCAGAGCTGCGATGCCG
 
. : . : . : . : . : . :
JMFN031K17- GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
JMFN039N07- GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
JMFF039F16- GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
JMFF015J02- GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
JMFF039E22- GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
rJMSF008O23+ GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
rJMSF033P11+ GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
rJMSF037P20+ GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
JMFS103B11- GGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
rJMSF046L15+ TCAGCCA
rJMFF010J22+ GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
rJMFF039E22+ GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
                      ____________________________________________________________
consensus GTTTAGTCAAGGTGAATCTAAGTGGATGCATTAATGTAACGGACAAAACAATTTCAGCCA
 
. : . : . : . : . : . :
JMFN031K17- TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
JMFN039N07- TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
JMFF039F16- TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
JMFF015J02- TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
JMFF039E22- TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
rJMSF008O23+ TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
rJMSF033P11+ TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
rJMSF037P20+ TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
rJMFF020K01+ CGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
JMFS103B11- TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
rJMSF046L15+ TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCNTAACGGTTGTGGATG-CGTT
rJMFF021M09+ ACGGTTGTGGATGCCGTT
rJMFF010J22+ TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
JMFN041F23- GCTGCTCAATCTTAACGGTTGTGGATG-CGTT
JMFN041D18- TCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
JMFN039N09- TCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
rJMFF039E22+ TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
rJMFF034H15+ TTGTGGATG-CGTT
rJMFF015J02+ CTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
                      ____________________________________________________________
consensus TTGCTAAACTACACGGGGAGACTCTCGAGCTGCTCAATCTTAACGGTTGTGGATG-CGTT
 
. : . : . : . : . : . :
JMFN031K17- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFN039N07- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFF039F16- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFF015J02- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFF039E22- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMSF008O23+ A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMSF033P11+ A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMSF037P20+ A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMFF020K01+ N-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFS103B11- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMSF046L15+ A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGNTCAGTTNTGC-GCGATCTTGATA
rJMFF021M09+ ACCCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGCGGCGATCTTGATA
rJMFF010J22+ A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFN041F23- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFN041D18- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFN039N09- A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMFF039E22+ A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMFF034H15+ A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMFF015J02+ A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMFF042I04+ AATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
JMFN029H05- GCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
rJMFF044M02+ GATA
                      ____________________________________________________________
consensus A-CCGATGCAAGTTTAGCCGCAATTGCAGACTATTGCTCAGTTCTGC-GCGATCTTGATA
 
. : . : . : . : . : . :
JMFN031K17- TTTCCAAATCTCG
JMFN039N07- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
JMFF039F16- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
JMFF015J02- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
JMFF039E22- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMSF008O23+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMSF033P11+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMSF037P20+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMFF020K01+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
JMFS103B11- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMSF046L15+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMFF021M09+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMFF010J22+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
JMFN041F23- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
JMFN041D18- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
JMFN039N09- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMFF039E22+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMFF034H15+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMFF015J02+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMFF042I04+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
JMFN011F07- TGCGATTC
JMFN029H05- TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
rJMFF044M02+ TTTCCAAATCTCGAGTCTCTGATTTTGGTATGNCAGCATTAGCCGGTGGCAGTGCGATTC
                      ____________________________________________________________
consensus TTTCCAAATCTCGAGTCTCTGATTTTGGTATTGCAGCATTAGCCGGTGGCAGTGCGATTC
 
. : . : . : . : . : . :
JMFN039N07- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFF039F16- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFF015J02- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFF039E22- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMSF008O23+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMSF033P11+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMSF037P20+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMFF020K01+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFS103B11- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMSF046L15+ AGTTTAGCTTGCAAATCCTTTCGCNATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMFF021M09+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMFF010J22+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFN041F23- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFN041D18- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFN039N09- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMFF039E22+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMFF034H15+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMFF015J02+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMFF042I04+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFN011F07- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
JMFN029H05- AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
rJMFF044M02+ AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
                      ____________________________________________________________
consensus AGTTTAGCTTGCAAATCCTTTCGCTATCGGGGTGTGTTTTGGCATCCGACAAGTGCTTGC
 
. : . : . : . : . : . :
JMFN039N07- CTTACTT
JMFF039F16- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
JMFF015J02- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
JMFF039E22- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMSF008O23+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMSF033P11+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMSF037P20+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF020K01+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
JMFS103B11- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMSF046L15+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF021M09+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF010J22+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
JMFN041F23- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
JMFN041D18- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
JMFN039N09- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF039E22+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF034H15+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF015J02+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF042I04+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMSF005A19+ GTTGGAA
rJMFF039F16+ GGGCTTGAACATACAGAATTGCGTTGGAA
JMFN011F07- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
JMFN029H05- CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF046M11+ CGGGCTTGAACATACAGAATTGCGTTGGAA
rJMFF044M02+ CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
                      ____________________________________________________________
consensus CTTACTTGCATAAGTTGGGCAATAGCCTTGCGGGCTTGAACATACAGAATTGCGTTGGAA
 
. : . : . : . : . : . :
JMFF039F16- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
JMFF015J02- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
JMFF039E22- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMSF008O23+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMSF033P11+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMSF037P20+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGGCTCTGGAGGTGCGATATCCTCTCGT
rJMFF020K01+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
JMFS103B11- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMSF046L15+ TCAGCCACCGCGGGGNTGATTTGCTCGNGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMFF021M09+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATA-CCTCTCGT
rJMFF010J22+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
JMFN041F23- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
JMFN041D18- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
JMFN039N09- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMFF039E22+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMFF034H15+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMFF015J02+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMFF042I04+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMSF005A19+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMFF039F16+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTNTGGAGGTGCGATATCCTCTCGT
JMFN011F07- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
JMFN029H05- TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMFF048M07+ TCGT
rJMFF046M11+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
rJMFF044M02+ TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
                      ____________________________________________________________
consensus TCAGCCACCGCGGGGTTGATTTGCTCGTGGAAAGACTCTGGAGGTGCGATATCCTCTCGT
 
. : . : . : . : . : . :
JMFF039F16- GAACCTAATCGGC
JMFF015J02- GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
JMFF039E22- GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMSF008O23+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMSF033P11+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMSF037P20+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF020K01+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
JMFS103B11- GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMSF046L15+ GAACNTAATCGGCCGTTCGAGTNTGGGGTATNNGAAGTAGTGTCTGTTGTCCAGNTANGT
rJMFF021M09+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF010J22+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
JMFN041F23- GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
JMFN041D18- GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
JMFN039N09- GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF039E22+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF034H15+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF015J02+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF042I04+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMSF005A19+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF039F16+ GAACCTAATCGGCCGTTCGNGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
JMFN011F07- GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
JMFN029H05- GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF048M07+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF046M11+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
rJMFF044M02+ GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
                      ____________________________________________________________
consensus GAACCTAATCGGCCGTTCGAGTTTGGGGTATCTGAAGTAGTGTCTGTTGTCCAGTTATGT
 
. : . : . : . : . : . :
JMFF015J02- TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGT
JMFF039E22- TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMSF008O23+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMSF033P11+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMSF037P20+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF020K01+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
JMFS103B11- TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMSF046L15+ TCTCGGTTTGTAGTTTACTTTTNGGGTCCATCGTGGGTTCTCGNGGT-CTGGTGTGTCAG
rJMFF021M09+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF010J22+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
JMFN041F23- TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
JMFN041D18- TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
JMFN039N09- TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF039E22+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF034H15+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF015J02+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF042I04+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMSF005A19+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF039F16+ TCTCGGTTTGTAGTTTACTTTTNGGGTCCATCGTGGGTTCTCGTGGTGGTGGTGTGTCAG
JMFN011F07- TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
JMFN029H05- TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF048M07+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF046M11+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
rJMFF044M02+ TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
                      ____________________________________________________________
consensus TCTCGGTTTGTAGTTTACTTTTTGGGTCCATCGTGGGTTCTCGTGGT-CTGGTGTGTCAG
 
. : . : . : . : . : . :
JMFF039E22- CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCT
rJMSF008O23+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMSF033P11+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMSF037P20+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF020K01+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
JMFS103B11- CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMSF046L15+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF021M09+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF010J22+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
JMFN041F23- CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
JMFN041D18- CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
JMFN039N09- CTCCTCTTTTTCCAGCGAGCATGGCTGCTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF039E22+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF034H15+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF015J02+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF042I04+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMSF005A19+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF039F16+ CTCNTCTTTTTCCAGNGAGCATGGCTGTTTTTCAAATTTTNTGCAGCTTCCACAAGCTGT
JMFN011F07- CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
JMFN029H05- CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF048M07+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF046M11+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
rJMFF044M02+ CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
                      ____________________________________________________________
consensus CTCCTCTTTTTCCAGCGAGCATGGCTGTTTTTCAAATTTTTTGCAGCTTCCACAAGCTGT
 
. : . : . : . : . : . :
rJMSF008O23+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMSF033P11+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMSF037P20+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMFF020K01+ TTCGAGAATTTTTTTCTNTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
JMFS103B11- TTCGAGAATTTTTTTC
rJMSF046L15+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTTC
rJMFF021M09+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMFF010J22+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
JMFN041F23- TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
JMFN041D18- TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
JMFN039N09- TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMFF039E22+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMFF034H15+ TTCGAGAATTTTTTTCTNTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMFF015J02+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMFF042I04+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMSF005A19+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMFF039F16+ TTCGAGAAT
JMFN011F07- TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
JMFN029H05- TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
rJMFF048M07+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTTTCATTTTCCACAGCCATTTTT-
rJMFF046M11+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTTTT-
rJMFF044M02+ TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
                      ____________________________________________________________
consensus TTCGAGAATTTTTTTCTCTGGGTCTCGCCCGGGGAGTCTCATTCTCCACAGCCATTCTT-
 
. : . : . : . : . : . :
rJMSF008O23+ CCCTGAGAATACCAGATGCTGGC-ATT
rJMSF033P11+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCT
rJMSF037P20+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCT
rJMFF020K01+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCT
rJMSF046L15+ CCCTGAGAATA-CAGATGCTGGC-ATT
rJMFF021M09+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGAT
rJMFF010J22+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCNTCGT
JMFN041F23- CCCTGAGAATA-CAGATGCTGGCNATTCTGGATCA-AGATTCTTGATGGTCTTCGTCAG
JMFN041D18- CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCA-AGATTCTTGATGGTCTTCGTCAG
JMFN039N09- CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCANAGATTCTTGATGGTCTTC
rJMFF039E22+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
rJMFF034H15+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCTTCGTC
rJMFF015J02+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
rJMFF042I04+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
rJMSF005A19+ CCCTGAGAATA-CAGATGCTG
JMFN011F07- CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
JMFN029H05- CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
rJMFF048M07+ CCCTGAGAATA-CAGATGCTGGC-ATTTTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
rJMFF046M11+ CCCTGAGAATA-CAGATGCTGGC-ATTTTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
rJMFF044M02+ CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
                      ____________________________________________________________
consensus CCCTGAGAATA-CAGATGCTGGC-ATTCTGGATCAAAGATTCTTGATGGTCTTCGTCAGG
 
. : . : . : . : . : . :
rJMFF039E22+ T
rJMFF015J02+ TA
rJMFF042I04+ TACTAGCTTACATTCAACC
JMFN011F07- TACTAGCTTACATTCAACC
JMFN029H05- TACTAGCTTACATTNCACCAAAAAAAAAAAAAA
rJMFF048M07+ TACTAGCTTACATTCAACCAAAAAAAAAAAAAAAAGAAAAAAAGAAAACGAAGAAAAAAG
rJMFF046M11+ TACTAGCTTACATTCAACCAAAAAAAAAAAAAAAAGAAAAAAAGAAAACGAAGAAAAAAG
rJMFF044M02+ TACTAGCTTACATTCAACC-AAAAAAAAAAAAAAAGAAAAAAAGAAAACGAAGAAAAAAG
                      ____________________________________________________________
consensus TACTAGCTTACATTCAACCAAAAAAAAAAAAAAAAGAAAAAAAGAAAACGAAGAAAAAAG